What does a report by a genetics counselor look like (genetics counseling)?

Well I'm not a genetics counselor, but I can tell you what would be in a report. Usually in that kind of job people want to know about their specific genetics and perhaps probabilities of certain conditions concerning their potential children. So something you might start with is a image called a karyotype. A karyotype is an image that shows all of the chromosomes in an individual. Using this you can often identify a lot of anomalies, mutations and other chromosomal behavior. For your report I'd just look any old karyotype image up since they generally always look the same unless you've got massive errors.

On top of that you can talk about a specific condition related to the karyotype. For example, Familial Downs Syndrome. If you look at someones chromosomes you can actually see this because it's the result of translocations gone awry. In a karyotype you might see extra material for chromosome 21 and it will be attached to another chromosome (like chromosome 14). People like this don't have Down's Syndrome, but they have a much higher likelihood of passing it on and a Genetic counselor would certainly be able to tell them this. Huntington's disease, and many other conditions can be spotted.

So if you want to do a really snazzy report, look up a disease or a condition that's caused by genetic mutations; there's no shortage of them. Find a neat karyotype to explain the conditions cause and the specifics. You can even go into making images that show the effects. For Huntington's, its caused by trinucleotide repeats happening over and over and over again. So a report would show how these repeats build up gradually until they reach a point where the person's function becomes disabled.

Something like an image showing CAG ---> CAGCAGCAGCAGCAGCAGCAGCAG (eventually there are so many the person displays symptoms)


Genetic counselors tend to have lots of diagrams, charts, images and things to simplify the genetics for common people. So go for pictures of what explains it and just be able to describe what's being seen. That's all there is to it.

Also you can use pedigrees, probability diagram displays based on parental genotypes, charts identifying present bases in the DNA and so on.