Virtual Molecular Lab: Crime Scene Forensics Worksheet

BIO/240 David Ormond Virtual Molecular Lab: Crime Scene Forensics Worksheet Learning Goal: To gather forensic evidence from a crime scene and match it to likely suspects. Prerequisite Knowledge: Before beginning this lab, you should be familiar with these concepts: how forensic scientists take advantage of genomic variations in noncoding regions of DNA the techniques of polymerase chain reaction (PCR) and gel electrophoresis Introduction: In recent years, law enforcement has been revolutionized by molecular biology. When human tissues are left behind at crime scenes, these tissues can be collected and processed to yield samples of DNA, which can then be treated to isolate specific DNA fragments that are highly variable in the human population. Statistically, any two people are very unlikely to have a matching set of these DNA fragments. Thus, if a DNA profile obtained from a suspect matches the DNA profile produced from crime-scene evidence, authorities can be very sure that the suspect was at the crime scene. In this lab activity, you will prepare DNA samples from four suspects, produce DNA profiles for each, and compare those profiles to one produced from DNA collected at a crime scene. Part A Investigators have recovered a strand of human hair from the ledge of a window where a burglar broke into a home. DNA has been extracted from the hair. Meanwhile, four suspects, all of whom have similar types of hair, have been apprehended and DNA samples have been taken from each of them. To produce DNA profiles for each suspect and for the hair sample, you will first need to amplify specific regions of the genomes where noncoding regions of DNA tend to be duplicated, or repeated. The specific number of repeats at such a region is likely to differ from one genome to the next. If you can isolate these DNA segments, amplify them, and perform gel electrophoresis, you will be able to compare the DNA profiles of the suspects with that of the DNA extracted from the crime-scene evidence. Enter the Molecular Lab Room by clicking the button. Then, follow the Lab Procedure. Lab Procedure Begin your analysis by gathering the samples. Roll over the five labeled microcentrifuge tubes in the tube rack to see which DNA samples they contain. A lab assistant has already added the Taq polymerase along with the raw nucleotide building blocks (dNTPs tag) that will be used to amplify the targeted fragments during polymerase chain reaction (PCR). Add Primers Before putting the tubes into the PCR machine, you need to add primers that will snip out the targeted regions of each genome. To do this, click on the primer control projector, which is located right behind the test tube rack. The primers you need for this process are not in the standard menu, so you need to copy/paste them into the blank field at the bottom of the primer selector. Here are the two primers to add: Left primer gaaactggcctccaaacactgcccgccg Right primer gcaaggggcacgtgcatctccaacaaga Copy/paste one primer into the blank field, and then click Add. It will appear at the top of the primer menu with an asterisk (*) to mark it. Clear the field at the bottom of the primer selector, and then copy/paste in the next primer and click Add. It will also appear at the top of the menu with an asterisk (*). Once these two custom primers are in the menu, select one of them from the menu and use the pipette icon to generate a pipette loaded with that primer. (The Primers door will open and close to indicate that the primer has been loaded, and the pipette will lean to the left.) Move the pipette over the first tube until it straightens up. Then, click on the pipette and it will lean to the right, indicating that the primer has been inserted into the tube. This image shows the three positions of the pipette and what they indicate. Reload the active pipette by clicking its tip on the pipette icon at the bottom of the primer window. Add the primer to the next tube. Continue this process of inserting and reloading until all five tubes have received the first primer. Select the other custom primer from the list, and add it to each tube following steps 5-7. Remember: If you fail to add both the left and right primer to each DNA sample you will not amplify a particular segment and your analysis will be inaccurate. Run PCR Your primed DNA samples are now ready for the PCR machine. (To review how to run the PCR, _watch_this_video_.) Open the PCR machine lid, and drag all of the tubes to the empty slots in the machine. Close the lid, and click the green arrow to start the PCR, which will amplify the targeted segment in each sample. Because PCR takes over 3 hours, use the arrows on the main clock to advance time by just over 3 hours, until the machine’s display reads complete. Open the PCR machine lid, and drag each tube back to the main tube rack. Maintain the original order of the tubes. Run Gel Electrophoresis Now that you have amplified the fragments, the next step is to load the samples into the gel and run gel electrophoresis. (To review how to run the gel, _watch_this_video_.) Click on the pipette on the lab bench, and hover over the tube labeled DNA from crime scene. The pipette will straighten up when it is in position to take up some of the DNA from the tube. Click, and the pipette will tilt to the left, indicating that it is loaded with that sample. Move the pipette over to the gel, which is near the front of the lab bench to the right of the PCR machine. Slowly move the pipette tip over the back edge of the gel until you see the words Well #2 appear in yellow. Click, and Well #2 will receive the DNA from crime scene fragments. As usual, the right-leaning pipette indicates that the pipette has been emptied. Repeat steps 12 and 13 for the other four samples. Be careful to not load more than one sample into any of the wells. Use the information below to coordinate the transfer of samples to wells. Sample Load into… Wells 1 and 10 are left alone because standard DNA ladders--nucleotide sequences that provide scale for the other samples--are already in those wells. DNA from crime scene Well 2 Suspect 1 Well 3 Suspect 2 Well 4 Suspect 3 Well 5 Suspect 4 Well 6 Now that the wells are loaded, you need to hook up the electrodes and turn on the gel. Grab the red (positive) electrode, and drag it to the terminal on the front left corner of the gel. Drag the black (negative) electrode to the other terminal, not far behind the positive one. Click on the main power button of the gel’s power supply, beneath the bench. A light above the button will glow red to indicate that the main power supply is on. To send the current through the gel and begin electrophoresis, click on the gray button that reads off. It will then read on, the light will turn green, and the gel will project into view overhead. As with other molecular biology processes, the gel takes some time to run its course. To speed the process, click on the arrows of the main clock to advance time by 10 minutes. As you click, the DNA fragments in the gel will move from the wells toward the positive end. To see how far the fragments traveled (which is an indication of how large they are), click on the UV button at the top of the gel viewer window. Analyze the gel by comparing the pattern of bands in the lanes. Pay special attention to the brightest band in each lane, where the amplified fragments of the targeted gene have accumulated in the gel. (Remember that Wells 1 and 10 were preloaded with standard DNA ladders that serve as scales for the fragments in the other wells. Lanes 2 through 6 show the targeted fragments from the crime-scene DNA and the four suspects.) Click the Save button in the gel viewer to save a black-and-white copy of the gel to your Lab Book. The gel image will remain in the Lab Book until you exit the Lab Room or close your browser window. Which band pattern among Lanes 3 to 6 seems to be the closest match to the band pattern in Lane 2, where the crime-scene DNA fragment was loaded? Which suspect appears to be the culprit? ANSWER: ____ Lane 3 (Suspect 1) ____ Lane 4 (Suspect 2) __X__ Lane 5 (Suspect 3) ____ Lane 6 (Suspect 4) Part B Use the horizontal tool (the circular icon in upper right of gel viewer) to measure the molecular weight, in base pairs, of the brightest band in each lane. Be sure to aim the horizontal tool’s line at the middle of a given fragment to measure its approximate size. What is the molecular weight (in base pairs) of the fragment in Lane 2 (DNA from the crime scene), Lane 3 (Suspect 1), Lane 4 (Suspect 2), Lane 5 (Suspect 3), and Lane 6 (Suspect 4)? ANSWER: Lane 2 is 421 Lane 3 is 1643 Lane 4 is 1989 Lane 5 is 421 Lane 6 is 330 Part C How does analyzing DNA profiles using the gel electrophoresis tool allow you to draw both qualitative and quantitative conclusions about the likely identity of the suspect in this case? ANSWER: The qualitative portion of the gel analysis is obtaining a match with the crime scene DNA based on how far the band migrates in the gel, which is indicative of the molecular weight of the fragment. The quantitative portion deals with the brightness or heaviness (size) of the matching bands, which is an indication of the quantity of the fragment that exists in the suspect sample compared to the crime scene sample. Part D Suppose the nucleotide sequence targeted by the primers in this activity is composed of a number of repeats of a single 16-base-pair sequence. In other words, every repeat within the targeted sequence means another 16 base pairs in the genome. Judging by the sizes of the fragments you measured in Part C, about how many repeats of the 16-base-pair sequence would you expect to find in each of the suspect’s genomes? ANSWER: Divide Part B suspect fragments by 16 Suspect 1 ~103 repeats Suspect 2 ~124 repeats Suspect 3 ~26 repeats Suspect 4 ~21 repeats Part E Think It Over In this lab activity, you targeted just one fragment of DNA to build the DNA profile of each suspect and the crime-scene sample. Real-world DNA profiles target multiple fragments. What is the advantage of targeting more than one fragment and having each DNA profile feature multiple bands? ANSWER: The greater the number of matching fragments between the crime scene sample and the suspect sample, the greater the probability that the suspect is indeed the perpetrator.