Genetics Practice Exam

Exam 2 Genetics Fall 2018 1. The Central Dogma of Molecular Biology is used to describe the flow of genetic information within a cell. Draw a flow chart of the central dogma and identify the processes involved in each step. (3) 2a. DNA and RNA each consist of long chains of nucleotides. List all of the possible nucleotides and which molecule you find them in. (4) 2b.What are the components that make up each nucleotide? (3) 3a. A mRNA molecule has the codon 5’-GCA. What is the anticodon found on the tRNA that complements this codon? (2) 3b. What amino acid would be attached to this tRNA? (2) 4. Describe the key experiments that showed that genes were composed of DNA. (8) 5. You are studying two variants of the same protein which have the following sequences: Variant 1: Met Val Pro Gln Ala Trp Tyr Glu Variant 2: Met Val Pro Gln Ala Gly Tyr Glu 5a. What is the mRNA sequence for each of the variants? For any position in which more than one nucleotide is possible, use the designation “Pu” for any nucleotide that could be either Purine, “Py” for any nucleotide that could be either Pyrimidine, and “N” for any nucleotide that could be either a Purine or a Pyrimidine. Be sure to label the 5’ and 3’ ends.(4) 5b. What kind of mutation resulted in the difference between the protein variants? (2) 6. Use the dsDNA sequence below to answer the following questions. AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT 6a. During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2) 6b. This segment of DNA includes the entire coding region of a gene. Which is the template strand and which is the coding strand? (3) 6c. What is the amino acid sequence of the protein encoded by this gene? (3) 6d. Imagine there is a mutation in the 12th base from the left where instead of a C top/ G bottom pair you now have an A top / T bottom pair. How will this change the protein encoded? (3) 7. List and describe the various levels of protein structure (6) 8. In what ways is a primary transcript modified in eukaryotic cells prior to translation? (4) 9a. How does a mRNA molecule in E. coli bind in the correct location of a ribosome? (3) 9b. What amino acid is attached to the initiator tRNA? (2) 9c. A tRNA moves through the binding sites of the ribosome in what order?(3) 10a. You insert genomic DNA from the killifish Fundulus heteroclitus into expression vectors containing a bacterial promoter and then transform bacterial cells with these recombinant vectors. You use an antibody for the killifish protein Superoxide Dismutase to screen the colonies. Would this work to find the colony transformed with the gene for Superoxide Dismutase? Why or why not? (3) 10b. Would your answer change if you had transformed yeast cells with these same recombinant vectors? Why or why not? (3) 11. Describe the process by which a prokaryotic cell makes a copy of its chromosome. (10) 12. Below are the results of a series of experiments on fruit flies with two different phenotypes. Flies with phenotype 1 can digest rotting fruit without any problem while those with phenotype 2 have a drunken appearance and sometimes even die from eating rotting fruit. The researchers hypothesize that the two phenotypes are the result of differences in the enzyme alcohol dehydrogenase (Adh), which catabolizes the ethanol produced when fruits rot. The researchers decide to do three tests of this hypothesis. First, they do a northern blot for Adh in individuals of both phenotypes. Second, they do a western blot for Adh in individuals of both phenotypes. Finally, they sequence a portion of the coding strand of the DNA of individuals of both phenotypes. The results of each are shown below. A. Interpret the results of the northern and western blots. B. Determine the coding sequences of the alleles of both phenotypes (label 5’ and 3’ ends). C. What do you hypothesize is the cause of the different phenotypes? (12 points) Match the term on the left with the correct definition on the right. (1 each) SNP ______ a. an enzyme that adds a sequence of adenines to the 3’ end of a mRNA molecule ß-pleated sheet ______ b. a DNA nucleotide that is lacking an OH on both the 2’ and 3’ carbon and has 3 PO4 RNA polymerase ______ c. a coding region within a gene d. the enzyme that catalyzes transcription Aneuploid ______ e. a secondary structure of a protein f. a ssDNA molecule that is labeled to allow identification of cDNA library ______ complementary pieces of ssDNA g. the concentration of purines is equal to the concentration of snRNA ______ pyrimidines in a DNA molecule h. molecules that are involved in exon splicing Probe ______ i. organisms in which a gene from a different organism has been inserted to confer a new function ddNTP ______ j. a ribozyme involved in binding amino acids together k. when bacterial cells ingest recombinant DNA plasmids Chargaff’s rule ______ l. cells that contain an extra copy of one or a couple of Individual chromosomes Intron ______ m. a collection of clones that contain recombinant DNA made by reverse transcription of mRNA Poly-A polymerase ______ n. the location on an enzyme where the substrate binds o. non-coding regions within the coding sequence of a gene Transgenics ______ p. the part of a mRNA molecule that binds to the ribosome q. an organism that contains more than two complete sets of Transformation ______ chromosomes that originate from different species r. an organism in which both functional copies of a gene have Allopolyploid ______ been replaced by non-functional copies s. a short piece of DNA that provides a binding site for Taq Primer ______ polymerase during PCR t. a single base pair within a DNA sequence that differs among members of a population u. a spiral shaped molecule Bonus: Get 2 points for each of the questions below that you can answer correctly. 1) What is the first and last name of your genetics professor? 2) What is the last name of one of the authors of your genetics textbook? 3) What school did your genetics professor obtain his Ph.D. from? Genetic Code U C A G U UUU - Phe UUC - Phe UUA - Leu UUG - Leu UCU - Ser UCC – Ser UCA - Ser UCG – Ser UAU – Tyr UAC – Tyr UAA – stop UAG – stop UGU – Cys UGC – Cys UGA – stop UGG – Trp C CUU – Leu CUC – Leu CUA – Leu CUG – Leu CCU – Pro CCC – Pro CCA – Pro CCG – Pro CAU – His CAC – His CAA – Gln CAG – Gln CGU - Arg CGC – Arg CGA – Arg CGG – Arg A AUU – Ile AUC – Ile AUA – Ile AUG – Met ACU – Thr ACC – Thr ACA – Thr ACG – Thr AAU – Asn AAC – Asn AAA – Lys AAG – Lys AGU – Ser AGC – Ser AGA – Arg AGG – Arg G GUU – Val GUC – Val GUA – Val GUG – Val GCU – Ala GCC – Ala GCA – Ala GCG – Ala GAU – Asp GAC – Asp GAA – Glu GAG – Glu GGU – Gly GGC – Gly GGA – Gly GGG - Gly