Title: Amino Acid Sequence Post by: tkwill on Oct 8, 2014 Item 7
A eukaryotic mRNA has the following sequence. The 5' cap is indicated in italics (CAP), and the 3' poly(A) tail is indicated by italicized adenines. 5'-CAP CCAAGCGUUACAUGAUAACGGACGAAGUA GAACUCCAACCAAUUAAUGGUUCAUGAGC ACCUAUGCUACCG AAAAAAAAAAAAAAAAAAAAAAAA-3' Part A Determine the amino acid sequence of the polypeptide produced from this mRNA. Express your answer as a sequence of three-letter amino acid abbreviations separated by dashes. Example: Val-Ile-His-...-Glu. Title: Re: Amino Acid Sequence Post by: padre on Oct 9, 2014 CCA AGC GUU ACA UGA UAA CGG ACG AAG UAG AAC UCC AAC CAA UUA AUG GUU CAU GAG CAC CUA UGC UAC CG
What have you done so far? I noticed AUG, that might be the start codon, so everything to the left is useless. Title: Re: Amino Acid Sequence Post by: tkwill on Oct 9, 2014 Going through I have
Pro-Ser-Val-Thr-Stop-Stop-Arg-Thr-Lys-Stop-Asn-Ser-Asn-Gln-Leu-Met-Val-His-Glu-His-Leu-Cys-Try-CG I'm confused what to do from here. Or which part is important? Also the CG at the end? I figured it out! Met-Ile-Thr-Asp-Glu-Val-Glu-Leu-Gln-Pro-Ile-Asn-Gly-Ser Title: Re: Amino Acid Sequence Post by: padre on Oct 10, 2014 I figured it out! Met-Ile-Thr-Asp-Glu-Val-Glu-Leu-Gln-Pro-Ile-Asn-Gly-Ser Thanks for the update, but how? Please explain. I was looking at the GC at the end, and didn't understand that either :-| |