|
Title: For the template strand of DNA listed below write out the RNA strand encoded by Post by: nasha on Mar 22, 2014 For the template strand of DNA listed below write out the RNA strand encoded by it:
DNA 3' G T A G C G T A C A G C T G A C G A A C G T G C A T T G C A A C A 5' mRNA 5' _____________________________ _____________________ 3' DO NOT INCLUDE ANY SPACES IN YOUR ANSWER Title: Re: For the template strand of DNA listed below write out the RNA strand encoded by Post by: Jermain_ on Mar 22, 2014 DNA 3' G T A G C G T A C A G C T G A C G A A C G T G C A T T G C A A C A 5' CAUCGCAUGUCGACUGCUUGCACGUAACG UUGU Title: Re: For the template strand of DNA listed below write out the RNA strand encoded by Post by: nasha on Mar 22, 2014 Thank you ;D
Title: Re: For the template strand of DNA listed below write out the RNA strand encoded by Post by: Jermain_ on Mar 24, 2014 :D
|