|
Title: How do I create a complimentary strand of DNA? Post by: wingbat on Sep 21, 2014 CFTR Gene.
5’ GAGACCATGCAGAGGTCGCCTCTGGAAAA GGCCAGC 3’ How do I replicate a complimentary strand for the above sequence and then translate it into MRNA and then translate this mRNA strand into the amino acid sequence for the beginning of the CFTR protein. Hint: what codon sequence is required to start translation? I am really struggling assistance would be greatly appreciated. Title: Re: How do I create a complimentary strand of DNA? Post by: bio_man on Sep 21, 2014 Everywhere you see:
C --> G T --> A A --> U G --> C And... 5' --> 3' 3' --> 5' |