|
Title: 1.Using the following DNA sequence, come up with your own corresponding sequence after a 1) point m Post by: WalkerS on Feb 26, 2019 1. Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation.
Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG 2. Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes. Title: Re: 1.Using the following DNA sequence, come up with your own corresponding sequence after a 1) ... Post by: bolbol on Feb 26, 2019 Content hidden
Title: Re: 1.Using the following DNA sequence, come up with your own corresponding sequence after a 1) poin Post by: Caitlyn Rose Morrow on Sep 14, 2020 thank you
thank you Title: Re: 1.Using the following DNA sequence, come up with your own corresponding sequence after a 1) ... Post by: Moon Drops on Oct 1, 2021 Thank You:)
|