|
Title: What are the amino acid sequences coded for by each mRNA? Post by: rjandmj82 on Sep 14, 2012 i dont understand this last part of my homework. Can anyone tell me the answer or tell me how to do it? I have the three anticodons for mRNA. Here they are:
#1 AUCCGGUAGCCUUAGUUUAC #2AUGCCCCCGAUUCUCUUGA #3AUGGACAAUUCGAUGUUUUAA any help is much appreciated! Title: What are the amino acid sequences coded for by each mRNA? Post by: MightofMjolni on Sep 14, 2012 U is correspondant to A and A is correspondant to U.
G is correspondant to C and C is correspondant to G. You are looking for the opposite nucleotide (A/U/C/G) for each of the three problems. So, first one: UAGGCCAUCGGAAUCAAAUG Try the other two on your own :) Title: What are the amino acid sequences coded for by each mRNA? Post by: julie7 on Sep 14, 2012 Content hidden
Title: What are the amino acid sequences coded for by each mRNA? Post by: tommychk0235 on Sep 14, 2012 These are the codons of mRNA and you have to find the amino acids coded by them. This will help you.
http://www.biologycorner.com/resources/codon.gif http://waynesword.palomar.edu/images/codon1.gif Title: What are the amino acid sequences coded for by each mRNA? Post by: rjt6250 on Sep 14, 2012 Go to the codon chart here: http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table
Codons are read in 3's, so for #1: AUC, CGG, UAG, CCU, UAG, UUU, AC AUC is isoleucine CGG is arginine UAG is actually a STOP codon, so this terminates the sequence so #1 is isoleucine-arginine #2 AUG is methionine, which is the important start codon, necessary for most protein synthesis to begin, so #1 above probably wouldnt make any protein, as it has no start codon, even though it does technically code for amino acids. so just continue #2, next is CCC = proline, CCG = proline, AUU isoleucine, all the way down. Usually you need sets of 3's, and in #1 you end with AC and #2 just has A, so idk what to tell you about that part |