Which of the following sequences contain a six-nucleotide inverted repeat?
A. GTCACGCGACGATACGGTCACG
B. GTCACGACTAGCCTAGTCGCTG
C. GTCACGACTAGCCATCAGCCTG
D. GTCACGACTAGCCCGACTAGTG
A scientist evaluates cellular mRNA and finds a population of transcripts that do not have a 3' poly(A) tail. However, these transcripts are translated into protein. What would these proteins most likely be?
A. ribosomal proteins
B. RNA binding proteins
C. DNA binding proteins
D. transport proteins.
Which of the following methods does not rely on the ability of nucleic acids to hybridize with each other?
A. cross species DNA hybridization for exploring evolutionary relationships
B. colony blot hybridization to identify a specific sequence from a collection of sequences that has been inserted into bacteria
C. Southern blotting for the detection of specific DNA fragments that have been separated by gel electrophoresis
D. Northern blotting for the detection of specific RNA fragments that have been separated by gel electrophoresis
E. Western blotting for the detection of specific proteins that have been separated by gel electrophoresis
Which of the following is the most likely explanation for the band pattern seen in lane 6?
A. Protein D is a restriction enzyme and cut the DNA fragment into two DNA fragments.
B. Protein D binding to the CRP-binding site is less tight compared to cAMP-CRP binding.
C. Protein D has a smaller mass than the cAMP-CRP protein.
D. Protein D removed radioactive label from the DNA fragment.
Polyadenylation of mRNA requires all of the following except:
A. Pol II extends the transcript beyond the site where the poly(A) tail is added.
B. The site of poly(A) addition is marked by specific sequence elements in the transcript.
C. The transcript is cleaved by an endonuclease that associates with the C-terminal domain of Pol II.
D. Polyadenylate polymerase uses a poly(U) RNA template to synthesize the poly(A) tail.