The "transforming principle" phenomena is the ability of dead pathogenic bacteria to pass

<1> The "transforming principle" phenomena is the ability of dead pathogenic bacteria to pass their disease-causing properties to live, non-pathogenic bacteria. The agent identified in the "transforming principle" put forth by F. Griffith was:

a) DNA

b) All nucleic acids

c) mRNA

d) tRNA
_____________________________ _____________________________ _____________________________ ___

<2> Hershey and Chase used radioactive isotopes to demonstrate that:

A) DNA tagged with viruses with radioactive 32P was then found in host cells directing the host to make new viruses

B) the radioactive isotopes 32P and 35S turned non-pathogenic viruses into pathogenic viruses
   
C) the protein coat of the viruses tagged with radioactive 35S was found in host cells directing the host to make new viruses

D) the radioactive isotopes 32P and 35S eradicated viruses effectively, thus not affecting the host cell
_____________________________ _____________________________ _____________________________ ___

<3> DNA replication starts at a specific nucleotide sequence called the:

A) Okazaki fragments

B) replication bubble

C) replication origin

D) polymeric forks
_____________________________ _____________________________ _____________________________ ___

<4> The function of helicase enzymes is to bind to DNA at the replication origin and:

A) unravel the twisted double helical structure of DNA
   
B) serve as a starting point for the attachment of new nucleotides
   
C) add new nucleotides one at a time to create a new strand of DNA
   
D) splice DNA fragments like a type of "DNA glue"
_____________________________ _____________________________ _____________________________ ___

<5> The leading strand is replicated continuously, but the lagging strand is:

A) replicated in short segments called Hershey transformations
   
B) replicated in short segments called Okazaki fragments
   
C) formed as one long strand by DNA primase
   
D) formed as one long strand by the enzyme DNA ligase
_____________________________ _____________________________ _____________________________ ___

<6> As the final nucleotides are added, the complete strands rewind automatically as a stable helix. The replication machine is dismantled in a process called:

A) dispersion

B) elongation

C) termination

D) transcription
_____________________________ _____________________________ _____________________________ ___

<7> Numerical Response 

Of the nitrogen-based molecules present in DNA, 17.5% are guanine molecules. Calculate the percentage composition of adenine molecules in the DNA.

Record your answer as a percentage rounded to one decimal place.

Answer:

HINT: See (sr) DNA.
_____________________________ _____________________________ _____________________________ ___

<8> RNA is different from DNA in all the following except:

A) ribose sugar replaces deoxyribose sugar

B) RNA is a single strand found in the nucleus and cytoplasm
   
C) uracil replaces thymine; (A = U)

D) it contains the bases cytosine, adenine, and guanine
_____________________________ _____________________________ _____________________________ ___

<9> Which correct descriptive terms fit the following statement? "A base sequence on DNA acts as a _____ allowing the enzyme _____ to open a section of DNA to build mRNA with complimentary nucleotides except that _____ replaces thymine."

A) promoter; DNA polymerase; uracil

B) mRNA primase; RNA polymerase; guanine

C) helicase; RNA polymerase; an anticodon

D) promoter; RNA polymerase; uracil
_____________________________ _____________________________ _____________________________ ___

<10> Transcription occurs:

A) in the nucleus where DNA makes a single strand mRNA molecule

B) in the nucleus where DNA replicates an exact copy of itself necessary for the growth of new cells

C) in the cytoplasm of cells where chemical codes are transferred to tRNA

D) at ribosomes, the site for building proteins such as cell structures, enzymes, and protein hormones
_____________________________ _____________________________ _____________________________ ___

<11> Complete question 7 on page 638 of the textbook.
A DNA strand contains the following nucleotide sequence:
TACTGCCTCCCCATAAGAATT

(a) What is the nucleotide sequence of the mRNA strand that is transcribed from this DNA template?  1 mark

(b) What is the amino acid sequence of the polypeptide that is produced from this mRNA strand?   2 marks
_____________________________ _____________________________ _____________________________ ___

<12> This activity demonstrates how DNA controls the synthesis of proteins. Proteins are made up of a chain of amino acids. You are to determine the original DNA code for part of a hemoglobin protein molecule, especially for the 3 amino acid chain of: threonine – proline -  glutamate.

Procedure: 

Write out the codon for each amino acid as used in the text and previous question. Label this set of 3 codons as mRNA. Above this mRNA, write out the corresponding DNA. This is the “sense strand”. Above the “sense strand”, write out the corresponding “anti-sense strand”. (The other side of helix can also be called the compliment.) Label and record the three lines of letters. Write out your answers on a scrap piece of paper and keep for the following questions. 3 marks:  (1 mark for labels; 2 marks for DNA molecule )
_____________________________ _____________________________ _____________________________ ___

<13> Messenger RNA (mRNA) is a single-stranded molecule that passes through nuclear pores into the cytoplasm to ribosomes situated on the endoplasmic reticulum. The triplet codons are read from mRNA as it passes through the ribosome. The function of tRNA is like that of a wheelbarrow as it brings the correct
amino acid to the work site at the ribosome for protein synthesis.

Complete the following blanks with the correct terms.


A tRNA (UGA) carries as its load, only the amino acid called 1. It plugs into the ribosome because its 2  , (UGA), matches the mRNA codon 3   (letters).
A different tRNA (GGG) carries only the amino acid 4 and its 5, (GGG), which allows it to match the mRNA codon 6 .
Another tRNA (CUU) carries the amino acid 7 and its anticodon (CUU), which allows it to match the mRNA codon 8.

Note: Each of these three lines have a similar type of answer for each location. Use this information to help you fill in the answer. For example, The last blank for each line is going to be a three letter code. 4 marks

1.
2.
3.
4.
5.
6.
7.
8.
_____________________________ _____________________________ _____________________________ ___

<14> When the tRNA anticodons match for the mRNA triplet codons, then the amino acid sequence synthesized is ______.  1 mark
Is this sequence the same as the order of amino acids in hemoglobin illustrated in the beginning of this exercise?  1 mark
_____________________________ _____________________________ _____________________________ ___

<15> What actually determines which amino acids are linked in a functional hemoglobin molecule?
_____________________________ _____________________________ _____________________________ ___

<16> A small section of the protein for human insulin is Phenylalanine-Valine-Asparagine-Glutamine-Histidine
What is the "sense strand" of DNA that would code for this portion of insulin?

   
A) CAC GAG AAC GTA TTC

B) AAG CAA TTA GTT GTA

C) AAA CAA TTC CAC CTA

D) TTC GTA AAC GAG CAC

HINT: amino acids ← tRNA ← ribosomes ← mRNA ←  DNA

Do you like going backwards? Where do you start? List all possibilities. A logic quest!
_____________________________ _____________________________ _____________________________ ___

<17> A permanent change in the genetic material of living tissue is called a:

A) somatic cell mutation

B) somatic cell transformation

C) viral germ line infection

D) germ line mutation
_____________________________ _____________________________ _____________________________ ___

<18> Through countless generations, DNA in the nucleus and mtDNA (mitochondrial DNA) have been passed to new generations. It is known that mtDNA is passed only from the mother to the child. By comparing mtDNA of living people and/or of skeletons of non-living people, researchers can analyze samples to determine their ancestry.

Which statement correctly accounts for the fact that mitochondrial DNA is passed only from mother to child?

A) An egg contributes both its nucleus and its cytoplasm to a zygote, and a sperm contributes only its nucleus.

B) Eggs contain mitochondria and sperm do not.

C) Mitochondrial DNA is transcribed from a template on the XY chromosome set.

D) Mitochondrial DNA is transcribed from a template on the XX chromosome set.
_____________________________ _____________________________ _____________________________ ___

<19> How is Cloning Done?

Natural cloning occurs with the creation of identical twins. This natural process involves the separation of early embryonic cells into two separate entities; each growing into a separate individual. Artificial cloning technique includes somatic cell nuclear transfer. This involves the transferring of genetic information.

What is the correct sequence of steps in somatic cell nuclear transfer? Include the description of the offspring.

1. the egg cell is stimulated to divide into an embryo   
2. offspring is identical to surrogate mother
3. genetic information is inserted into an egg cell
4. sperm cell is collected as donor cell
5. offspring is identical to body cell donor
6. embryo is implanted into surrogate mother
7. donor genetics is collected from a body cell
8. offspring is identical to egg donor
9. an egg cell is enucleated

Numerical Response

Starting with an enucleated egg (9), select the next 5 correct steps and record the numbers in order as your answer. 5 marks
_____________________________ _____________________________ _____________________________ ___