General Biology

12 years ago

When carbon dioxide moves from the blood to the air space in the lungs, how many

When carbon dioxide moves from the blood to the air space in the lungs, how many layers of cell membrane must it pass through?

tenor1456 964 1 Reply

12 years ago

Need help with PhysioEx 8.0 exercise 5

1. Was the effect of viscosity greater or less than the effect of radius on fluid flow? Why?
(I'm fairly certain that the effect was less than the effect of radius but I'm not sure why)

2. What effect would anemia have on bl

godjohnson03 1101 1 Reply

12 years ago

Physioex 9.0 ex 3

OMG, somebody help!!

mercym35 38475 2 Replies

12 years ago

please help me i'm having trouble

Describe the implications of the Human Genome project? Please can someone help me out..

bigmama99 2164 6 Replies

dsmith

12 years ago

Please Help!

I will greatly appreciated it if someone could help with these three question. This is from PhysioEx 9.0 Exercise 9.

22. List the several “mechanisms” you have explored that change the GFR. How does each of them specifically alter th

marcosdaniels 886 2 Replies

ppk

12 years ago

PhysioEx 9.0 Lab 9 - Activity 2 Question 13

When the valve between the collecting duct and the urinary bladder was closed and when the beaker pressure was 100mmHg, the GFR was approximately _____ ml/min and the urine volume was approximately ______ ml.
a. 100; 100
b. 110;

CntStopMe 1630 2 Replies

CntStopMe

12 years ago

Does anyone have the answers to physio ex 9.0 activity 2

dboy 1223 1 Reply

12 years ago

The Origin of Species

Fully formed complex characters
1. show the same purpose throughout their
evolutionary history.
2. evolve in one step.
3. evolve through a series of small evolution-
ary changes.
4. evolve over a short period of time, in

nicolenam 884 1 Reply

12 years ago

Specificity of the adaptive immune system and its ability to distinguish...

1. Suppose that for whatever reason some of the T cells that exit the thymus as mature competent T cells are self reactive, does that necessarily mean that they will end up attacking self tissues because they can recognize the self antigen they

with.out.name 1423 7 Replies

12 years ago

Can anyone help answer the unanswered questions and check the rest.

Exercise H: Histology Tutorial
Assignment Due: Extra Credit

Student instructions: Follow the step-by-step instructions for this exercise found in your text and record your answers in the spaces below. Submit th

Nicholle87 21469 4 Replies

12 years ago

The Evolutions of Population (Help, please)

The frequency of an allele ‘a’ in a natural
population is 0.25.
What is the percentage of the homozygous
population for this allele?
Answer in units of %

Thank you in advance. If you can include how to calculate, it wo

nicolenam 897 1 Reply

12 years ago

If a mistake is made, even in one nucleotide, what would you predict would occur in hemoglobin synth

~ If a mistake is made, even in one nucleotide, what would you predict would occur in hemoglobin synthesis?

kasy110 6360 4 Replies

dmbethel

12 years ago

Couple Questions About The Peppered Moth

What variation exists in the peppered moth population? Is one of these variations considered an adaptation? Explain.

Over 200 years ago, all of the peppered moths in a certain population were light-coloured. How could the first dark-colour

mbergsmann 1111 1 Reply

12 years ago

Lab 2 Worksheet The Cell Cycle and Cancer

Can someone assist me? I am doing the simulation but I can't figure out how I suppose to record the phases when for all? Or Do you have the answers?

dawnas30 3681 1 Reply

12 years ago

tropic hormone

Choose the incorrect response for the following question. The term tropic, as in "tropic hormone", indicates that the hormone
a.released from the hypothalamus directs the anterior pituitary to release FSH, which causes the ovary to dev

chie 6619 3 Replies

colleen

12 years ago

Complete the following blanks with the correct terms.

A tRNA (UGA) carries as its load only the amino acid called _________.
It plugs into the ribosome because its ________, (UGA) matches the mRNA codon _________. (letters)
A different tRNA (GGG) carries only the amino acid _________ and its _

kasy110 7508 4 Replies

12 years ago

Children born with Xeroderma Pigmentosum must have a lifestyle with very...

6. Children born with Xeroderma Pigmentosum must have a lifestyle with very specific guidelines. All the following are reasonable guidelines for affected children except
a. application of SP+30 sunblock when going outdoors
b. shielding from

kasy110 2886 3 Replies

12 years ago

What is the ''sense strand'' of DNA that would code for this portion of insulin?

a small section of the protein for human insulin is Phenylalanine - Valine - Asparagine - Glutamine - Histidine. What is the ''sense strand'' of DNA that would code for this portion of insulin?
A) TTC GTA AAC GAG CAC
B)

kasy110 2845 2 Replies

12 years ago

The organelles used by cells to produce cell membranes, respiratory enzymes, or

The organelles used by cells to produce cell membranes, respiratory enzymes, or protein hormones are
a) ribosomes
b) lysosomes
c) mitochondria
d) nucleoli

kasy110 4223 2 Replies

12 years ago

Which correct descriptive terms fit the following statement?

Which correct descriptive terms fit the following statement?
''A base sequence on DNA acts as a __________ allowing the enzyme ____________ to open a section of DNA to build mRNA with complimentary nucleotides except that ___________ r

kasy110 1965 2 Replies

12 years ago

Punnett Squares (gene formulas, pattern of inheritance)

USE THE PICTURE FOR QUESTIONS 27 and 28

27. Choose the correct GENE FORMULA for each of the following locations on the Punnett Square. PICTURE IS ATTACHED

Gene Formula :

Alleles 1 =
Alleles 2 =
Geno

YMCMB 3072 2 Replies

12 years ago

What is a strict anaerobe?

For my Final study guide I have to differentiate Obligate, Facultative, and Strict Anaerobe. I got the definitions for Facultative and Strict Anaerobes but can't find anything in my textbook or online on Strict Anaerobes. What is a strict anaero

crazy 835 1 Reply

12 years ago

The initial cause of a genetic disorder in an affected child likely results from

Amniocentesis enables medical specialists to perform tests about genetic disorders. A genetic marker is found using a DNA probe. The initial cause of a genetic disorder in an affected child likely results from the presence of abnormal
a) DNA in

kasy110 4453 1 Reply

12 years ago

Some Events that Occur in a Cell during the Synthesis of Protein...

Some Events that Occur in a Cell during the Synthesis of Protein
1) mRNA nucleotides are fused into a long chain
2) Amino acids join in a chain
3) Double helix of a DNA uncoils
4) Polypeptide is released
5) tRNA anti codons m

kasy110 4470 4 Replies

12 years ago

All the following are true of hormones except that hormones

All the following are true of hormones except that hormones


excite specific responses from target cells


often affect target cells distant from the cells that secreted them


are chemical messages se

chie 731 1 Reply

12 years ago

Genotype and phenotypes (plant breeder and fruit flies)

21. A plant breeder was trying to produce a true-breeding variety of radishes with an oval shape. However, each time plants with oval radishes were self-pollinated, only half of the offspring were oval. The rest of the plants produced were either rou

YMCMB 1445 4 Replies

12 years ago

Measuring Respiratory Volumes and Calculating Capacities

ACTIVITY 1: Measuring Respiratory Volumes and Calculating Capacities

1.   Which of the following processes does not occur during inspiration?
a.   The diaphragm moves to a flattened position.
b.   Gas pressure inside the lungs i

CAR3153 3891 3 Replies

lausengc

12 years ago

Which of the following statements is false?

DNA synthesis begins at origin of replication
Loading of origin recognition complex is triggered by S-Cdk

Please let me know, thanks!

orientalbeat 894 1 Reply

12 years ago

PhysioEx 9.0 Exercise 6

21. Describe why Ringer’s solution is required to maintain heart contractions.

sep825 5444 3 Replies

12 years ago

What is the nucleotide sequence of the mRNA strand that is transcribed from...

What is the nucleotide sequence of the mRNA strand that is transcribed from the DNA template TACTGCCTCCCCATAAGAATT ?
And what is the amino acid sequence of the polypeptide that is produced from this mRNA strand?

kasy110 2295 7 Replies

12 years ago

Lizards phenotype and genotypes

Suppose that on Venus Lizards exist with three genes controlling spotted skin color. The gene for brown spots (S^B) is dominant to both the gene for green spots (S^G) and the gene for orange spots (S^O). The gene for green spots is also dominant to t

YMCMB 1255 2 Replies

Engegiohefe

12 years ago

That which corresponds to the mRNA codons of CCA, AUG, and GCA is...

That which corresponds to the mRNA codons of CCA, AUG, and GCA is
a) glycine, methionine, proline
b) glycine, tyrosine, arginine
c) proline, terminator codon, alanine
d) proline, initiator codon, alanine

kasy110 3373 4 Replies

12 years ago

Transciption in the nucleas

Transcription in the nucleus..
Does
a) DNA make a single strand mRNA molecule?
b) DNA replicate an exact copy of itself?

kasy110 1089 5 Replies

12 years ago

Jim Fitch decided that his physique left much to be desired, so he joined a local health club and be

. Jim Fitch decided that his physique left much to be desired, so he joined a local health club and began to "pump iron" three times weekly. After three months of training, during which he was able to lift increasingly heavier weights, he n

Sherri044 10056 3 Replies

JoAnne

12 years ago

About how many in the family would you expect to have red and terminal owers

In garden peas axial ?owers are dominant
over terminal and red ?owers over white. The
number of plants in the F2 population was
10,000.
About how many in the family would you
expect to have red and terminal ?owers?
1. 56

nicolenam 3509 3 Replies

12 years ago

Physioex Review Sheet 11

What Waste produce is increased with an increased rate of metabolism?[font=comic sans ms][/font]

mom2turtle 1353 2 Replies

colleen

12 years ago

Challenging genetics problems!

What would be the proportion of the double
recessive class in a dihybrid cross involving
two pairs of contrasting characters in the F2
progeny, assuming that the allele for each trait
is dominant over the other?
1.9/16
2

nicolenam 2933 1 Reply