Cell Biology

1. what neurotransmitters open sodium channels? acetylcholine, gaba, glycine or all of the above?

1. what neurotransmitters open sodium channels? acetylcholine, gaba, glycine or all of the above?

2. creatine phosphate and atp the "quick" energy source of... a. compact bone, b. skeletal muscle, c. all cells, or a&b?

3. which is a sympatheticomimetic drug? a. belladonna, b. atabrine, c. atropine or a&c?

firestrike   658   2 Replies

rkim12

1. Which of the following is NOT true regarding monoclonal antibodies?

1. Which of the following is NOT true regarding monoclonal antibodies?

A. They are produced from plasma cells derived from different B cells.
B. They are formed when B lymphocytes are fused with malignant plasma cells.
C. The antibodies produced are all of the same type.
D. They are used in the diagnosis of various dise

Askelto2   579   1 Reply

rizza mae

1.) Which is not true of the light-dependent reactions?

1.) Which is not true of the light-dependent reactions?

       A.) Water is broken into H+, and electrons are released; O2 is a by-product.
       b.) ATP is synthesized using the energy from the electron transport chain.
      c.)  NADP+

Angela95   557   1 Reply

bio_man

1.Entropy is increased when nutrients breakdown so why are enzymatic metabolic

1.Entropy is increased when nutrients breakdown so why are enzymatic metabolic

1.   Entropy is increased when nutrients breakdown so why are enzymatic metabolic pathways required for cellular respiration

cldavis9   2214   4 Replies

John Valdez

1.Explain the chemical equation for cellular respiration.

1.Explain the chemical equation for cellular respiration.

1.   Explain the chemical equation for cellular respiration.  Why is it important to understand the chemistry and cellular activities when studying human pathology?

skinnypup   422   1 Reply

Alexx

1.In which of the following cases is a motivati

1.In which of the following cases is a motivati

An employee commits a tort to promote the principal's business, outside work premises.
An employee commits an intentional tort against another employee at work premises.
An employee commits an unintentional tort that helps promote the

Andrea171989   374   1 Reply

bio_man

15.18What is the nitrogen-containing group at the C alpha atom of amino acids c

15.18What is the nitrogen-containing group at the C alpha atom of amino acids c

can someone help me?
Thanks

Post Merge: 9 years ago

What is the nitrogen-containing group at the C alpha atom of amino acids called

and

what are the reactions available for

itsche86   366   1 Reply

ortho2122

1st Ig isotype produced during cource of 1° imm.response has which heavy chain?

1st Ig isotype produced during cource of 1° imm.response has which heavy chain?

A.   γ
B.   κ
C.   δ
D.   μ
E.   None of the above

evan888   329   N/A

evan888

2 Questions - Fatty acids on membrane + Digestine enzymes exocytosis

2 Questions - Fatty acids on membrane + Digestine enzymes exocytosis

Hello, i'm struggling on answering these questions.   


Can you please provide me a modal answer i put the marks next to the questions, as they are past exam questions. 



Some of the fatty-a

noobtouch   2444   1 Reply

bio_man

2 questions for Microbiology

2 questions for Microbiology

Please Help!!


1. Describe emerging diseases, resurgence of old diseases, and chronic diseases caused by bacteria.

2. Compare and contrast the major cell wall components of the prokaryotes, archaea, and fungi. why are these

whitecaddy26   1423   4 Replies

whitecaddy26

2. Describe the three types of cells of the immune system. 3. Where are lymphocytes produced? 4. What?

2. Describe the three types of cells of the immune system. 3. Where are lymphocytes produced? 4. What?

Name the two main components of the immune system.



2. Describe the three types of cells of the immune system.



3. Where are lymphocytes produced?



4. What are the two types of immunity?

ilndrz   449   2 Replies

Leonium

2. The graph below shows the relationship between glucose concentration outside

2. The graph below shows the relationship between glucose concentration outside

2. The graph below shows the relationship between glucose concentration outside a cell and the rate of glucose diffusion across a cell membrane that has carrier proteins to facilitate diffusion.

 

1. Which of the following repre

arealhero   498   3 Replies

milestone23

21) Salmonella heidelberg gastroenteritis occurred on three cruises aboard the T

21) Salmonella heidelberg gastroenteritis occurred on three cruises aboard the T

21) Salmonella heidelberg gastroenteritis occurred on three cruises aboard the T.S.S. Festivale. Figure 14.4 shows on-board clinic visits for diarrheal illness between February 10 and March 3.

a.   Explain the incidence pattern shown on the

barry   6970   5 Replies

barry

23) Compare and contrast enzymes and ribozymes of self-splicing introns.

23) Compare and contrast enzymes and ribozymes of self-splicing introns.

23) Compare and contrast enzymes and ribozymes of self-splicing introns.

colleen   1562   1 Reply

chemb

3 Questions need help!!!!

3 Questions need help!!!!

Question 11

What is the role of water in photosynthesis?
    a.   Water donates electrons to the electron transport chain.
    b.   Water captures light energy and transfers it to the electron transport chain.
    c.   Water provides a

fitz8546   614   1 Reply

nite_n_day

3 types of ATP-generating phosphorylation

3 types of ATP-generating phosphorylation

Hi,

This is from Microbiology: An Intro 10th ed. by Tortora, Funke, Case. Learning Objectives Ch. 5, p. 121:

5-9. List and provide examples of 3 types of phosphorylation reactions that generate ATP.

Cheers!

microbeman   9528   2 Replies

microbeman

3-phosphoglycerate is to C3 plants as ________ is to C4 plants. (Fill in the blank)

3-phosphoglycerate is to C3 plants as ________ is to C4 plants. (Fill in the blank)

3-phosphoglycerate is to C3 plants as ________ is to C4 plants.
 
  Fill in the blank with correct word.

souljahwitch   52   1 Reply

haylsm112

4) Using YOUR microscope, you calculated the actual size of a cell as 3 micrometres on medium power. What will?

4) Using YOUR microscope, you calculated the actual size of a cell as 3 micrometres on medium power. What will?

the field of view on low power is 4.5 mm
medium 1.8 mm
high 0.18 mm
plzzzzz help

rkarthik301   457   1 Reply

julesh22

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complem

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complem

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complementary sequence of the other strand? What will be the complementary mRNA sequence derived from the second strand of DNA? Be sure to indicate the 5' or 3�

colleen   1306   1 Reply

bio_man

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complementary sequence of ...

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complementary sequence of ...

5'-ATAGGGCTT-3' is a short sequence of a strand of DNA. What will be the complementary sequence of the other strand? What will be the complementary mRNA sequence derived from the second strand of DNA? Be sure to indicate the 5' or 3' ends of each seq

edwii   112   2 Replies

edwii

5-bromouracil mimics the chemical structure of thymine, making it a(n) __________ of thymine.

5-bromouracil mimics the chemical structure of thymine, making it a(n) __________ of thymine.

5-bromouracil mimics the chemical structure of thymine, making it a(n) __________ of thymine.

cuchillo   390   3 Replies

archie90

5`CCUAUGGCAACAUCAUCAUGAGCA3` (Multiple Choice Question)

5`CCUAUGGCAACAUCAUCAUGAGCA3` (Multiple Choice Question)

MET codon encountered in the mRNA sequence. B) Label the N and C termini of the protein.

Leen   384   1 Reply

tonesmith

6) Homologous proteins (Multiple Choice)

6) Homologous proteins (Multiple Choice)

6) Homologous proteins
A) share a common ancestor.
B) share a common amino acid sequence.
C) are determined by alleles on homologous chromosomes.
D) A and B only
E) A, B, and C

Skill:  Factual recall

barry   1632   2 Replies

barry

6H2S + 6CO2 label_arrow_right_over(light) 6S0 + glucose

6H2S + 6CO2 label_arrow_right_over(light) 6S0 + glucose

6H2S + 6CO2  label_arrow_right_over(light)  6S0 + glucose
A) takes place under aerobic conditions.
B) takes place under anaerobic conditions.
C) The amount of oxygen does not make any difference.

suo90821   446   3 Replies

montgomery

?Which of the following mediate final docking between target and vesicle.  ?

?Which of the following mediate final docking between target and vesicle.  ?

Which of the following mediate final docking between target and vesicle.  

A)  V-SNARES
 ?B) t-SNARES
 ??C) Adaptins
?D) A and B are correct
?E) A,B and C are correct
 

micro205   542   1 Reply

buffzyzz

A _______ section is made through the human brain and is parallel to the ground

A _______ section is made through the human brain and is parallel to the ground

A  _______ section is made through the human brain and is parallel to the ground, and a _______ section through the spinal cord is parallel to the ground.
a. transverse; horizontal
b. horizontal;  transverse
c. sagittal; mids

colleen   757   1 Reply

ThePsychic

A _______section made perpendicular to the ground and parallel to the neuraxis

A _______section made perpendicular to the ground and parallel to the neuraxis

A  _______section made perpendicular to the ground and parallel to the neuraxis through a human brain divides the brain into two symmetrical halves.
a. parasagittal
b. horizontal
c. midsagittal
d. frontal
e. transverse

colleen   1087   1 Reply

ThePsychic

A ________ consists of the extrafusal fibers innervated by a single alpha motor

A ________ consists of the extrafusal fibers innervated by a single alpha motor

A  ________ consists of the extrafusal fibers innervated by a single alpha motor neuron.
a. myofibril tangle
b. motor unit
c. extrafusal junction
d. intrafusal contact
e. muscle spindle

colleen   642   1 Reply

ThePsychic

A "summer cold" that lasts for weeks and is characterized by sore throat, mild fever, ...

A "summer cold" that lasts for weeks and is characterized by sore throat, mild fever, ...

A "summer cold" that lasts for weeks and is characterized by sore throat, mild fever, dry cough, and malaise may be (pneumococcal/staphylococcal/walking) pneumonia.

Anook   73   2 Replies

Anook

A 14-year-old female client with constitutional growth delay tells a nurse, I am not getting any ...

A 14-year-old female client with constitutional growth delay tells a nurse, I am not getting any ...

A 14-year-old female client with constitutional growth delay tells a nurse, I am not getting any taller I am the same height I was last year How should the nurse respond?
 
  1. I will refer you to an endocrinologist.
  2. You should

browniels   68   1 Reply

umass508

A 16-year-old male presents to the clinic complaining of headaches, trouble hearing the teacher in ...

A 16-year-old male presents to the clinic complaining of headaches, trouble hearing the teacher in ...

A 16-year-old male presents to the clinic complaining of headaches, trouble hearing the teacher in the front of the classroom, and ringing in the ears.
 
  He also revealed that every time he goes swimming underwater, he gets disorientated

SnowQueen   57   1 Reply

alarose

A 17 year old woman died of a sudden rupture of an aortic aneurysm during a basketball game. She ...

A 17 year old woman died of a sudden rupture of an aortic aneurysm during a basketball game. She ...

A 17 year old woman died of a sudden rupture of an aortic aneurysm during a basketball game.  She was tall with long arms and legs and hyperextensibility in her digits.  Her parents were apparently normal.
What was the most likely caus

mkzb   289   1 Reply

arbar

A 17-year-old boy has pus-filled cysts on his face and upper back. Microscopic examination reveals ...

A 17-year-old boy has pus-filled cysts on his face and upper back. Microscopic examination reveals ...

A 17-year-old boy has pus-filled cysts on his face and upper back. Microscopic examination reveals gram-positive rods. This infection is caused by
A) Streptococcus pyogenes.
B) Propionibacterium acnes.
C) Staphylococcus aureus.
D)

suo90821   258   3 Replies

Vaddim

A 2-week-old infant (full-term at birth) is admitted to the pediatrics unit with spitting up large ...

A 2-week-old infant (full-term at birth) is admitted to the pediatrics unit with spitting up large ...

A 2-week-old infant (full-term at birth) is admitted to the pediatrics unit with spitting up large amounts of formula and diarrhea. The infant has developed a weak suck reflex.
 
  Which of the following statements about total body water (

SnowQueen   39   1 Reply

derrickpate22

A 21-month old child was admitted into the hospital with fever, severe abdomi

A 21-month old child was admitted into the hospital with fever, severe abdomi

5) A 21-month old child was admitted into the hospital with fever, severe abdominal cramps, and diarrhea.  The family revealed they had purchased an iguana one month previously and the child had helped clean the cage.  What bacterium was th

ajoh4573   679   1 Reply

doseofmegan

A 25-year-old male presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis ...

A 25-year-old male presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis ...

A 25-year-old male presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis was based on serological testing. The patient then reported that he had an ulcer on his penis two months earlier. This disease can be treated with

suo90821   156   3 Replies

TheItor

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Diagnosis was based on serological testing. The patient then reported that he had an ulcer on his penis two months earlier. What stage of disease is the patient

suo90821   154   3 Replies

Luichen

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of the following causative agents is most likely to cause these symptoms?
A) Treponema
B) Candida
C) HPV
D) HSV-2
E) Nesseria

suo90821   165   3 Replies

Vaddim

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of ...

A 25-year-old man presented with fever, malaise, and a rash on his chest, arms, and feet. Which of the following will be most useful for a rapid diagnosis?
A) serological test for antigen
B) microscopic examination of blood
C) serologi

suo90821   152   3 Replies

borque89

A 25-year-old man suffering from pulmonary tuberculosis was found to have normocytic normochromic ...

A 25-year-old man suffering from pulmonary tuberculosis was found to have normocytic normochromic ...

A 25-year-old man suffering from pulmonary tuberculosis was found to have normocytic normochromic anemia. Serum iron and total iron binding (TIBC) levels were low, but serum ferritin was high normal.
 
  The bone marrow was normocellular,

ejohnson3310   50   1 Reply

alarose