Explore
Post homework questions online and get free homework help from tutors.
Learn More
Improve Grades
Help Others
Save Time
Accessible 24/7
Ask a Question Take the Tour Study Tips
Gallery
498
0
04/30/15
48
0
03/16/17
19
0
03/06/17
460
0
06/19/12
Poll
Should there be a limit to WiFi usage in cafes?
Completely Agree
Somewhat Agree
Completely Disagree
If you would like to vote in this poll, please login or register
Previous poll results: What's your favorite coffee beverage?
Home Q & A Board Science-Related Homework Help Chemistry (Moderators: Laser_3, ford1001)
New Topic    
Subject
Last post
An hour after a meal, a patient's blood glucose level is 180 mg/dL. Express this glucose level as ...
An hour after a meal, a patient's blood glucose level is 180 mg/dL. Express this glucose level as ...
An hour after a meal, a patient's blood glucose level is 180 mg/dL. Express this glucose level as mass/mass percent concentration. (Assume the density of blood is 1.0g/mL.)
kaitlynnesi   26   1 Reply
2 days ago
Uppose a tire has a pressure of 29.5 lb/in.2 . Convert 29.5 lb/in.2 to its equivalent in atmospheres
Uppose a tire has a pressure of 29.5 lb/in.2 . Convert 29.5 lb/in.2 to its equivalent in atmospheres
suppose a tire has a pressure of 29.5 lb/in.2 . Convert 29.5 lb/in.2 to its equivalent in atmospheres.
sperson   17   1 Reply
3 days ago
Calculate the predicted atomic radius for radioactive polonium, given the radius of selenium (0.116
Calculate the predicted atomic radius for radioactive polonium, given the radius of selenium (0.116
Calculate the predicted atomic radius for radioactive polonium, given the radius of selenium (0.116 nm) and tellurium (0.143 nm)
kjfrank1814   20   1 Reply
4 days ago
A can of hairspray has a volume of 684 mL and contains 6.43 g of carbon dioxide as the propellant ...
A can of hairspray has a volume of 684 mL and contains 6.43 g of carbon dioxide as the propellant ...
A can of hairspray has a volume of 684 mL and contains 6.43 g of carbon dioxide as the propellant what is the pressure inside the can at 25°C?
Post Merge: 6 days ago

5.23
Markyb978   23   N/A
Medium
6 days ago
How many moles of oxygen gas can 0.88 mole of hydrogen peroxide (H2O2) produce, if decomposition is ...
How many moles of oxygen gas can 0.88 mole of hydrogen peroxide (H2O2) produce, if decomposition is ...
How many moles of oxygen gas can 0.88 mole of hydrogen peroxide (H2O2) produce, if decomposition is complete?
arielskinner1   35   1 Reply
A week ago
Assume that the temperature and quantity of a gas sample remain constant. A 1.6 L sample of gas is ...
Assume that the temperature and quantity of a gas sample remain constant. A 1.6 L sample of gas is ...
Assume that the temperature and quantity of a gas sample remain constant. A 1.6 L sample of gas is originally at 330 K and 4.84 atm. Calculate the final pressure when the volume is reduced to 840 mL.
3.66 atm
4.61 atm
9.22 atm
18.
colynnb17   50   1 Reply
Medium
1 weeks ago
Suppose that in a certain collection of nuclei there were initially 1024 nuclei and 20 minutes later ...
Suppose that in a certain collection of nuclei there were initially 1024 nuclei and 20 minutes later ...
Suppose that in a certain collection of nuclei there were initially 1024 nuclei and 20 minutes later there was only one nuclei left, the others having decayed. On the basis of this information, how many nuclei would you estimate decayed in the first
Northa   130   2 Replies
2 weeks ago
Polonium-215 alpha decays with a half life of 1.8 ms.(a)How much is left after 1. second?(b)What is ...
Polonium-215 alpha decays with a half life of 1.8 ms.(a)How much is left after 1. second?(b)What is ...
Polonium-215 alpha decays with a half life of 1.8 ms.
(a)   How much is left after 1. second?
(b)   What is the daughter nucleus?
Northa   179   2 Replies
2 weeks ago
Composite particles that are composed of three quarks are calledA) leptons.B) hadrons.C) mesons.D) ...
Composite particles that are composed of three quarks are calledA) leptons.B) hadrons.C) mesons.D) ...
Composite particles that are composed of three quarks are called
A) leptons.
B) hadrons.
C) mesons.
D) bosons.
E) baryons.
Northa   52   2 Replies
2 weeks ago
A fusion reaction works because the binding energy of the resulting nucleusA) is greater than the ...
A fusion reaction works because the binding energy of the resulting nucleusA) is greater than the ...
A fusion reaction works because the binding energy of the resulting nucleus
A) is greater than the binding energy of the original nuclei.
B) is equal to the binding energy of the original nuclei.
C) is less than the binding energy of t
Northa   97   2 Replies
2 weeks ago
Photons associated with the magnetic field used in magnetic resonance imaging have considerably less ...
Photons associated with the magnetic field used in magnetic resonance imaging have considerably less ...
Photons associated with the magnetic field used in magnetic resonance imaging have considerably less energy than the photons used in CT scans.
Northa   42   2 Replies
2 weeks ago
Chemistry question
Chemistry question
Hydrochloric acid reacts with barium hydroxide according to the equation: 

Calculate the heat (in kJ) associated with the complete reaction of 18.2 grams of HCl (aq).
 

-29.5
 

-236
 
AuntieColleen   33   1 Reply
2 weeks ago
Hot to get molarity of HCL
Hot to get molarity of HCL
Calculate the molarity of Hydrochloric acid solution in the original 25mL sample..the molarity of NaOH is 0.1M.

Sample data table.

Molarity of base = 0.1M
Volume of acid = 25mL
Final buret reading = 35.7mL
Initia
Tx29   44   1 Reply
2 weeks ago
Lost: what are the Net Ionic equations for the following
Lost: what are the Net Ionic equations for the following
What are the Net ionic equation for the following:

1.) FeCl3(aq) + NaOH(aq)

2.) CuSO4(aq) + KOH(aq)

3.) Zn(s) + HCl(aq)

4.) CaCl2(aq) + H2SO4(aq)

5.) Fe(NO3)3(aq) + KOH(aq)

6.) HNO3(aq
Tx29   38   1 Reply
2 weeks ago
Buckminsterfullerene is a molecule composed solely of carbon atoms. If one molecule has a mass of ...
Buckminsterfullerene is a molecule composed solely of carbon atoms. If one molecule has a mass of ...
 Buckminsterfullerene is a molecule composed solely of carbon atoms. If one molecule has a mass of 1.197 x 10-21grams, what is the formula of the molecule?
Tx29   47   1 Reply
2 weeks ago
What is the coefficient of NaCl after balancing the following equation? __CrCl3(aq) + __Na2CO3(aq) ...
What is the coefficient of NaCl after balancing the following equation? __CrCl3(aq) + __Na2CO3(aq) ...
What is the coefficient of NaCl after balancing the following equation?

__CrCl3(aq) + __Na2CO3(aq) → __Cr2(CO3)3(s) + __NaCl(aq)
paulamaui1   46   1 Reply
3 weeks ago
The use of high-pressure chambers to control disease processes is known as __________.
The use of high-pressure chambers to control disease processes is known as __________.
The use of high-pressure chambers to control disease processes is known as __________.
mwatts   47   1 Reply
3 weeks ago
A suitable method to use for quantitation of HIV in patient blood is:A) Southern blot.B) SDA.C) DNA ...
A suitable method to use for quantitation of HIV in patient blood is:A) Southern blot.B) SDA.C) DNA ...
A suitable method to use for quantitation of HIV in patient blood is:
A) Southern blot.
B) SDA.
C) DNA sequencing.
D) bDNA.
steden   35   1 Reply
3 weeks ago
Labeled antibodies are used as probes to detect proteins in:A) Southern blot.B) Western blot.C) ...
Labeled antibodies are used as probes to detect proteins in:A) Southern blot.B) Western blot.C) ...
Labeled antibodies are used as probes to detect proteins in:
A) Southern blot.
B) Western blot.
C) Hybrid capture assay.
D) Northern blot.
DNA27   26   1 Reply
3 weeks ago
More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:A) The ...
More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:A) The ...
More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:
A) The temperature is decreased.
B) The size of the probe is increased.
C) The temperature is increased.
D) The salt concentration is decreased.
DNA27   29   1 Reply
3 weeks ago
Real-time PCR differs from traditional PCR in that:A) The reaction requires hybridization probes.B) ...
Real-time PCR differs from traditional PCR in that:A) The reaction requires hybridization probes.B) ...
Real-time PCR differs from traditional PCR in that:
A) The reaction requires hybridization probes.
B) The amplicon is detected as the reaction progresses.
C) The amplicon is detected on a special fluorescent gel.
D) Primers are no
DNA27   23   1 Reply
3 weeks ago
Which of the following fragments would be generated when the following sequence is cut by SmaI?5' ...
Which of the following fragments would be generated when the following sequence is cut by SmaI?5' ...
Which of the following fragments would be generated when the following sequence is cut by SmaI?
5' TACCCCGGGGGCAATTCCCGGGAGATTCC CGGGAACTC 3'
A) One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment
B) Two 19 bp fragm
steden   21   1 Reply
3 weeks ago
Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart ...
Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart ...
Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is:
A) Pulse-field gel electrophoresis.
B) Denaturing gel electrophoresis.
C)
DNA27   18   1 Reply
3 weeks ago
Which of the following is NOT a component of a nucleotide?A) Nitrogenous baseB) Phosphate groupC) ...
Which of the following is NOT a component of a nucleotide?A) Nitrogenous baseB) Phosphate groupC) ...
Which of the following is NOT a component of a nucleotide?
A) Nitrogenous base
B) Phosphate group
C) Amino acid
D) 5' carbon sugar
DNA27   15   1 Reply
3 weeks ago
The protein product derived from the DNA sequence below contains which of the following amino acid ...
The protein product derived from the DNA sequence below contains which of the following amino acid ...
The protein product derived from the DNA sequence below contains which of the following amino acid sequences?
DNA: 3' TACTTTCGCGGAACT 5'
A) Methionine-lysine-alanine-proline
B) Tyrosine-phenylalanine-arginine-glycine
C)
DNA27   15   1 Reply
3 weeks ago
RNA differs from DNA in that RNA:A) Is used to carry the genetic information of most viruses.B) ...
RNA differs from DNA in that RNA:A) Is used to carry the genetic information of most viruses.B) ...
RNA differs from DNA in that RNA:
A) Is used to carry the genetic information of most viruses.
B) Contains an H group instead of an OH group at its number 2 carbon.
C) Is normally single-stranded.
D) Contains thymine instead of ur
DNA27   12   1 Reply
3 weeks ago
All of the following are clinical applications of FISH EXCEPT:A) Detection of chromosome ...
All of the following are clinical applications of FISH EXCEPT:A) Detection of chromosome ...
All of the following are clinical applications of FISH EXCEPT:
A) Detection of chromosome microdeletions.
B) Monitoring patients with sex-mismatched bone marrow transplants for engraftment.
C) Detecting DNA from tumor-causing viruses i
DNA27   15   1 Reply
3 weeks ago
Restriction endonucleases function by:A) Breaking the DNA randomly to create fragments of manageable ...
Restriction endonucleases function by:A) Breaking the DNA randomly to create fragments of manageable ...
Restriction endonucleases function by:
A) Breaking the DNA randomly to create fragments of manageable size.
B) Linking 2 pieces of DNA from different sources.
C) Cutting the DNA at specific nucleotide sequences.
D) Adding a phosph
steden   13   1 Reply
3 weeks ago
Which of the following is true about gel electrophoresis of DNA?A) Increasing the voltage increases ...
Which of the following is true about gel electrophoresis of DNA?A) Increasing the voltage increases ...
Which of the following is true about gel electrophoresis of DNA?
A) Increasing the voltage increases the resolution of DNA fragments separated in the gel.
B) DNA migrates toward the cathode.
C) DNA electrophoresis requires polyacrylami
DNA27   13   1 Reply
3 weeks ago
How much DNA would be contained in 200 μg of a sample that has an absorbance at 260nm of 0.40 and ...
How much DNA would be contained in 200 μg of a sample that has an absorbance at 260nm of 0.40 and ...
How much DNA would be contained in 200 μg of a sample that has an absorbance at 260nm of 0.40 and an absorbance at 280nm of 0.20?
A) 4 μg
B) 8 μg
C) 6 μg
D) 10 μg
steden   14   1 Reply
3 weeks ago
Which of the following is a step in the process of translation?A) RNA polymerase binds to the ...
Which of the following is a step in the process of translation?A) RNA polymerase binds to the ...
Which of the following is a step in the process of translation?
A) RNA polymerase binds to the promoter sequence.
B) Introns are removed from the transcript.
C) Anticodons on the tRNAs bind to their complementary codons on mRNA.
D
DNA27   17   1 Reply
3 weeks ago
The melting temperature (Tm) of the DNA sequence given below is:5' TAACCTATGCGA 3'3' ATTGGATACGCT ...
The melting temperature (Tm) of the DNA sequence given below is:5' TAACCTATGCGA 3'3' ATTGGATACGCT ...
The melting temperature (Tm) of the DNA sequence given below is:
5' TAACCTATGCGA 3'
3' ATTGGATACGCT 5'
A) 38°C
B) 34°C
C) 24°C
D) 12°C
steden   11   1 Reply
3 weeks ago
Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure ...
Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure ...
Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT:
A) A low patient white blood
DNA27   13   1 Reply
3 weeks ago
Which vitamin is a component of two redox coenzymes?A) Vitamin AB) Vitamin B2C) Vitamin CD) Folic ...
Which vitamin is a component of two redox coenzymes?A) Vitamin AB) Vitamin B2C) Vitamin CD) Folic ...
Which vitamin is a component of two redox coenzymes?
A) Vitamin A
B) Vitamin B2
C) Vitamin C
D) Folic acid
DNA27   9   1 Reply
3 weeks ago
Niacin is converted to which of the following two cofactors?A) Nicotinamide-adenine dinucleotide and ...
Niacin is converted to which of the following two cofactors?A) Nicotinamide-adenine dinucleotide and ...
Niacin is converted to which of the following two cofactors?
A) Nicotinamide-adenine dinucleotide and nicotinamide-adenine dinucleotide phosphate
B) Thiamine pyrophosphate and biotin
C) Flavin adenine dinucleotide (FAD) and flavin mono
steden   11   1 Reply
3 weeks ago
Pellagra is associated with a deficiency of which of the following vitamins?A) Vitamin B12B) Vitamin ...
Pellagra is associated with a deficiency of which of the following vitamins?A) Vitamin B12B) Vitamin ...
Pellagra is associated with a deficiency of which of the following vitamins?
A) Vitamin B12
B) Vitamin B3
C) Vitamin D
D) Vitamin B2
steden   10   1 Reply
3 weeks ago
Rickets in children or osteoporosis in adults can be minimized though dietary supplementation with ...
Rickets in children or osteoporosis in adults can be minimized though dietary supplementation with ...
Rickets in children or osteoporosis in adults can be minimized though dietary supplementation with which of the following?
A) Vitamin A
B) Vitamin K
C) High doses of ascorbic acid
D) Vitamin D, calcium, and phosphorus
steden   12   1 Reply
3 weeks ago
Which of the following is described as a nervous system ailment because of a deficiency of ...
Which of the following is described as a nervous system ailment because of a deficiency of ...
Which of the following is described as a nervous system ailment because of a deficiency of thiamine?
A) Multiple sclerosis
B) Parkinson disease
C) Pellagra
D) Beriberi
DNA27   10   1 Reply
3 weeks ago
Measurement of vitamin B12 concentration in serum using an immunoassay is an example of which of the ...
Measurement of vitamin B12 concentration in serum using an immunoassay is an example of which of the ...
Measurement of vitamin B12 concentration in serum using an immunoassay is an example of which of the following?
A) Indirect assay
B) Direct assay
C) Bioassay
D) Screening assay
steden   10   1 Reply
3 weeks ago
A patient presents with the following symptoms:∙Loss of appetite∙Generalized weakness and ...
A patient presents with the following symptoms:∙Loss of appetite∙Generalized weakness and ...
A patient presents with the following symptoms:
   ∙   Loss of appetite
   ∙   Generalized weakness and irritability
   ∙   Abdominal pain and vomiting
   ∙   Bright red tongue (glossitis)
   ∙   Skin rash ("Casal's necklace")
DNA27   17   1 Reply
3 weeks ago
New Topic    
Home Q & A Board Science-Related Homework Help Chemistry (Moderators: Laser_3, ford1001)