Genetics and Developmental Biology

Read "Thought Lab 20.1 on page 706 in the textbook. Complete Procedure Questions 1-5.

Read "Thought Lab 20.1 on page 706 in the textbook. Complete Procedure Questions 1-5.

Read "Thought Lab 20.1 on page 706 in the textbook. Complete Procedure Questions 1-5.

Jamie Lyn   52   N/A

Jamie Lyn

Identify the phenotypes and genotypes of all the people shown in this pedigree.

Identify the phenotypes and genotypes of all the people shown in this pedigree.

Complete Practice Problem 20 on page 615 in the textbook. Identify the phenotypes and genotypes of all the people shown in this pedigree. Rolling the tongue (R) is dominant over inability to roll the tongue as it remains flat (r).


Hi

CutiepieKen   1905   1 Reply

Anonymous

The effect of Ca2+ channel blockers on formation of the fertilization envelope

The effect of Ca2+ channel blockers on formation of the fertilization envelope

The role of Ca2+ ions in the formation of the fertilization envelope and blocking polyspermy can be further studied using Ca2+ channel blockers. As their name suggests, Ca2+ channel blockers block the movement of Ca2+ ions through channels. In the ca

adrii01   16150   13 Replies

Elene Shengelia

Determining parental and F1 genotypes in crosses involving polygenic inheritance

Determining parental and F1 genotypes in crosses involving polygenic inheritance

You decide to designate the alleles of the four loci as either additive (contributing to fruit segment number and represented by a superscript “+”) or non-additive (not contributing to fruit segment number and represented by a superscript “0”). Using

123

KendraJo   11335   33 Replies

Drake Daugherty

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

For the molecular defects listed below, predict what their effects would be on AR signaling and ultimately on the development of the genital

1234

dimplepatel2013   15689   47 Replies

Logan Tully

Part D - Adjusting probabilities based on new information

Part D - Adjusting probabilities based on new information

Individual IV-3 is born as a male affected with condition B but not condition A. His parents are bred again, and an ultrasound shows that the fetus is another male. The relevant portion of the pedigree is shown below.

Use this new informat

hotthot12   43752   12 Replies

baabs lol

Probability of Eye Gene

Probability of Eye Gene

How is the answer A

You are a genetic counselor and a couple has come to you asking your
advice. The female of the couple, Jane, has a rare disease of the eye
that causes blindness at puberty. In addition, all of Jane's si

Anonymous   138   1 Reply

bio_man

People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals w

People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals w

36.People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals with alkaptonuria have arthritis as well as urine that darkens when exposed to air. Both nail­patella syndrome and alkaptonuria are rare phenotypes.

12

sonya36   4848   27 Replies

benajamin

No one else posted this, so I thought I would: Punnett Squares

No one else posted this, so I thought I would: Punnett Squares

When Gregor Mendel conducted his genetic experiments with pea plants, he observed that a trait’s inheritance pattern was the same regardless of whether the trait was inherited from the maternal or paternal parent. Mendel made these observations by ca

theturkey   19642   8 Replies

Isabella “Bella” Rada

How to draw a 2N=6 cell in both mitosis and meiosis

How to draw a 2N=6 cell in both mitosis and meiosis

I am having trouble trying to figure out how to draw a cell in mitosis and in meiosis.

For example, how do you draw a 2N=6 cell with chromosomes in mitosis during prophase, metaphase, anaphase, and telophase

How would you draw

sjohn092   8372   8 Replies

Snook Orionov

Support need it please 10 questions SEE IMAGES

Support need it please 10 questions SEE IMAGES

1) Which row correctly identifies the function and source of hCG, respectively?

a.Function                                Source
Stimulates FSH  &nb

Anonymous   378   5 Replies

Carolina Castillo2

I need help with this questions is one long and 4short

I need help with this questions is one long and 4short

1) In guinea pigs, a black coat (B) is dominant over a white coat (b), and straight hair (S) is dominant over curly hair (s). A heterozygous, black, and straight hair guinea pig (BbSs) was test crossed.


A) Which of the following rows

Anonymous   456   3 Replies

Carolina Castillo2

Number of yeast's chromosome

Number of yeast's chromosome

How to know about the number of yeast's chromosome? Is there any method to know aout that ?

Anonymous   217   1 Reply

bio_man

Coefficient of relatedness puzzle

Coefficient of relatedness puzzle

In the Mahabharat, Dhritarashtra was the son of Sage Vedavyas and Ambika, whereas Pandu was the son of Sage Vedavyas and Ambalika. Ambika and Ambalika were full sisters. What is the coefficient of relatedness between Dhritarashtra and Pandu?

EgonSpengler   188   2 Replies

EgonSpengler

Identify which pattern(s) of transmission is/are impossible. Specify why transmi

Identify which pattern(s) of transmission is/are impossible. Specify why transmi

Identify which pattern(s) of transmission is/are impossible. Specify why transmission is impossible. (AD = autosomal dominant, AR = autosomal recessive, XR = X-linked recessive, XD = X-linked dominant)


Please Please help me with thi

sam01   4468   10 Replies

dharts8274

Recombination and the Role of Chromosomal Exchange

Recombination and the Role of Chromosomal Exchange

I read my genetic book for this, but I can't seem to find the answers. Please help if possible.

PART A
The discernible difference in length between the two X chromosomes of the female fruit fly was important in Stern’s experimen

JaeYang   1197   1 Reply

bolbol

Functional, nonfunctional enzymes

Functional, nonfunctional enzymes

For the genotypes and conditions (lactose present or absent), predict whether functional enzymes, nonfunctional enzymes, both types (functional and nonfunctional enzymes), or no enzymes are made. For example, for the genotype I + O +Z + under the no

srmtrc   3762   4 Replies

Berkay Güzelaydın

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations.  In order for children to have this trait, at least one parent must have woolly hair.  How is this trait most likely inherited? Draw a pedigree for a family

smand   2730   9 Replies

mriya225

Dna sequence help

Dna sequence help

I’ve got these two images, not sure what they show. I’ve got an exam on them but we haven’t got the questions yet. Can anyone help with what it shows or any ideas on what the question could be?

Any help would be appreciated
Thank yo

Anonymous   231   1 Reply

doubleu

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

As you have determined, the F1 is heterozygous for four loci that affect fruit segment number (A+ A 0 B+ B 0 C+ C 0 D+ D 0). This means that the F1 can produce 16 distinct gamete typ

12345

paramed91   8363   56 Replies

kkim

Three of the most prominent definitions of species are the biological species concept, the phylogene

Three of the most prominent definitions of species are the biological species concept, the phylogene

Part A - Comparing species definitions
Three of the most prominent definitions of species are the biological species concept, the phylogenetic species concept, and the morphological species (morphospecies) concept.
Drag each characteristic

123

hunter4565   75870   31 Replies

bioresearch

how do i do this question

how do i do this question

Which of the following are potential restriction enzyme sites (circle candidates)(2 marks)?
a. 5’-aggcct b. 5’-ttataa c. 5’-gaccag d. 5’-ttaatt

which are the answer

toodaloo   502   1 Reply

bolbol

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an unstrained circle?  (L = linking number, T = twist and W = writhe)

A) L = 12, T = 12, W = 0
B) L = 11, T = 11, W = 0
C) L = 11, T =

bogdan   366   2 Replies

Anonymous

DNA Essay Comp

DNA Essay Comp

Hello!

I'm currently working on writing an essay from a competition with the following prompt:

"Many human diseases have a genetic component. Some diseases result from a change in a single gene or even multiple genes

Anonymous   325   5 Replies

bio_man

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci assort independently, determine the following proportions:


gametes that are expected to carry only dominant alleles.
Express your answer using thr

12

sjohn092   10750   26 Replies

Hausr

Part B - How can someone with a Y chromosome develop as a female?

Part B - How can someone with a Y chromosome develop as a female?

One key determinant of sex determination is the SRY gene itself. This gene is located on the Y chromosome, and the protein it encodes is a DNA binding protein that regulates other genes. The normal action of the SRY protein is to induce transcr

123

dimplepatel2013   11485   30 Replies

urine tsunami

Gene Interaction - Mastering Chemistry, Alleles?

Gene Interaction - Mastering Chemistry, Alleles?

Based on your analysis so far, you assign the following allele symbols to the three lines:
Wild type = A_ V_
Aberdeen White = a a
Kansas Yellow = aYaY
Victoria White = v v

Using these symbols, assign genotypes to the

12...78

loljaneysaur   16594   99 Replies

Noor Amin

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles have the genotype A2A2, while lighter beetles have an A1A1 genotype; heterozygotes have a phenotype that is closer to that of the A1A1 homozygotes. Th

pkclary   2419   4 Replies

mastema

Is this what the transcribed mRNA would look like?

Is this what the transcribed mRNA would look like?

So there's a DNA sequence with a double stranded
DNA with a open reading frame encoding a small
polypeptide 5'
ATGGAGGAACCGCAGTCAGATCCTAGCTA GGTC3'
3' TACCTCCTTGGCGTCAGTCTAGGATCGAT CCAG 5'
So the mRNA t

Question Bio   221   1 Reply

bio_man

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

I'm attempting to replicate a yeast transformation from a paper. The paper denotes that the strain which generated the best results as follows:

Name: ST9482
Parental Strain: ST9318
Added DNA Element: pC

germinate_love   511   5 Replies

dietervdwes

1 question different parts

1 question different parts

Use the following information to answer the next four questions.

Tomato Plant Leaves
In tomatoes, regular leaves (L) are multilobed and serrated and potato leaves (l) are broad, smooth, and single (Image 1). Red fruit (F) is dominant

Anonymous   819   11 Replies

Yvane KKL

What are Homologous Chromosomes? Are They Present in All Cells?

What are Homologous Chromosomes? Are They Present in All Cells?

I need help precisely answering the attachment below

Identify Homologous Chromosomes and Sister Chromatids in appropriate phases.
What are homologous chromosomes? Are they present in all cells? If not, which
cells lack homologo

Fedoraman   293   4 Replies

bio_man

2 questions answer all parts please

2 questions answer all parts please

1) Match the following formulas with their correct descriptions form the drop down menu provided.

Formulas

1. Dp equals N over A
2 Dp equals N over V
3. increment N equals open parentheses N plus I close parentheses mi

Anonymous   472   6 Replies

inaayaz

11 questions i Need support ASAP

11 questions i Need support ASAP

1) Which of the following statements correctly describes a Y-linked trait?

a.  It can be inherited by a daughter from her father.

b. It will always be expressed if present in male individuals. 

c.  It

Anonymous   755   6 Replies

kumbu gozo

Who is the father of Snowball

Who is the father of Snowball

Here is a question from my bio homework:

At a local buffalo farm an albino calf named Snowball is born. Snowball is the first albino buffalo born to this herd. The allele for albinism is recessive to the allele for normal coloration. Snowb

12

jessicawcu   7216   15 Replies

THAVY VANTHON

Mapping with trihybrid (three-point) test crosses! Help?

Mapping with trihybrid (three-point) test crosses! Help?

You examine 450 progeny from the cross in Part C and classify them according to phenotype. The results are shown in the table below.

!See Below Image!

Use these data to complete the linkage map shown below.
Drag the blue la

12

hunter4565   24197   14 Replies

carlgru

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crim

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crim

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crimson have a red abdomen. (Wild-type abdomens are yellow.)

You make pure-breeding crimson (cc) and triple-mutant (apricot, blunt, crimson) li

123

sammiebb   18835   34 Replies

farida Abdelgawad

A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three ...

A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three ...

Q; A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three are speckled black and white, and one is white.
a) What can you infer about the inheritance patterns of the alleles for white and black feathers

Jess8219   4266   12 Replies

andresgs04

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for  (BLANK) to occur                                           &nbs

alwhite   591   1 Reply

bolbol

3 questions some are attached please answer all I NEED IT NOW THANKS

3 questions some are attached please answer all I NEED IT NOW THANKS

1) See first image 
Identify the phase(s) from the image above that best illustrates each of the following stages of mitosis AND include your explanation of why. (2 marks).

a. Interphase
b. Prophase
c. Metaphase

Anonymous   479   4 Replies

Noa Mastin