× Didn't find what you were looking for? Ask a question
  
  
Top Posters
Since Sunday
7
j
7
s
7
e
6
6
b
6
f
6
s
6
6
j
5
n
5
p
5
New Topic  
Anonymous Annonn
wrote...
A month ago
The following sequence of nucleotides is found in a single-stranded DNA template:

AGCATACAGCAGACCGTTGGTCTGAAAAA AGCATACA


A) Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5’ and which end is 3’? Explain your answer.


B) Assume this DNA template sequence comes from the end of a bacterial transcription unit. Where will transcription terminate? Explain your answer, including the structure-function relationship.
Read 86 times
1 Reply

Related Topics

Replies
Anonymous
wrote...
A month ago
AGCATACAGCAGACCGTTGGTCTGAAAAA AGCATACA

TAC is the antisense DNA equivalent of the start codon "AUG".

During transcription, the RNA polymerase read the template DNA strand in the 3′→5′ direction, but the mRNA is formed in the 5′ to 3′ direction.

Hence:

3'-AGCATACAGCAGACCGTTGGTCTGAAAAA AGCATACA-5'

Quote
B) Assume this DNA template sequence comes from the end of a bacterial transcription unit. Where will transcription terminate? Explain your answer, including the structure-function relationship.

It is known that the termination of the transcription in the bacteria happens by two different mechanisms:

1. Rho-dependent
2. Rho-independent
 
The Rho-dependent transcription termination happens because of the presence of the Rho protein which dissociates the RNA polymerase whereas the Rho-independent mechanism works by making a hairpin loop in the transcript(mRNA) which sends a signal to stop the transcription.

To make a hairpin loop and show how that can be made in the mRNA we first translate this given sequence into the mRNA. We know that following are the complementary nucleotide to the DNA in the RNA as shown below.

A T C G = DNA
U A G C = RNA

the complementary binding is essential to make the mRNA from the DNA. the T is replaced by U(Uracil) in the RNA when it transcribes. keeping these rules in the mind we will transcribe the given sequence to the mRNA as follow

AGCATACAGCAGACCGTTGGTCTGAAAAA AGCATACA= DNA Sequence
AGCAUACAGCAGACCGUUGGUCUGAAAAAAGCAUACA = mRNA Sequence

To show that Rho-independent transcription termination is possible in this mRNA we have to find the ability of this mRNA sequence to form a hairpin loop

If we take GUU which is highlighted as the head of the hairpin we can make a hairpin.

If we took 5 nucleotides upstream of the G of GUU and 5 nucleotides downstream to the second U in GUU these sequences are palindromic in nature and can form a hairpin.

We have used an online tool known as VECTORBUILDER to find out if this sequence have any ability to form hairpin loop as shown in the picture:

{attached}

Once the hairpin is formed it will send signal to the RNA polymerase and this will stop the transcription
Attached file
Thumbnail(s):
You must login or register to gain access to this attachment.
New Topic      
Explore
Post your homework questions and get free online help from our incredible volunteers
  313 People Browsing
 483 Signed Up Today
Related Images
  
 1053
  
 50
  
 32
Your Opinion
Do you believe in global warming?
Votes: 345

Previous poll results: Who's your favorite biologist?