× Didn't find what you were looking for? Ask a question
Top Posters
Since Sunday
New Topic  
Anonymous Annonn
wrote...
A year ago
The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form

5’ – AGATTCAGGTCGAACATTATAGTCCAACT ATACGGCGTTATGTCAATCCGCA – 3’
3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGA TATGCCGCAATACAGTTAGGCGT – 5’



A) Is this a bacterial cell or a eukaryotic cell?

Bacterial cell – It has a -10 consensus sequence and a -35 consensus sequence
Eukaryotic cell - It has a TATA box
Eukaryotic cell - It has a start codon
Bacterial cell – It has only a single chromosome


B) Which is the template strand (top or bottom)?

Top - Where the TATA box is found
Top - Opposite of where the holoenzyme RNA polymerase attaches to the promoter
Bottom - Where the holoenzyme RNA polymerase attaches to the promoter
Bottom - Opposite where the TATA box is found


C) Which direction is upstream (left or right)?

Right - the promoter lies upstream of the transcription start site
Right - the promoter lies downstream of the transcription start site
Left - the promoter lies upstream of the transcription start site
Left - the promoter lies downstream of the transcription start site





Read 134 times
1 Reply

Related Topics

Replies
Anonymous
wrote...
A year ago
Bacterial cell – It has a -10 consensus sequence and a -35 consensus sequence
Bacterial cells don't have -10 and -35 consensus sequences.

Bacterial cell – It has only a single chromosome
By having the sequence only we can't decide the chromosome number so this answer is false

Eukaryotic cell - It has a TATA box
The tata box has sequence TATAWAWN (where W=A or T, and N is any nucleotide) located 30 base-pairs upstream of the start site of transcription. but this sequence is not present.

Eukaryotic cell - It has a start codon
Right: the start codon in the DNA present as TAC which transcribes as AUG in the RNA so this is the right answer because this sequence does have a TAC sequence in the given DNA sequence

B) Which is the template strand (top or bottom)?

Top - Where the TATA box is found
Top - Opposite of where the holoenzyme RNA polymerase attaches to the promoter
Bottom - Where the holoenzyme RNA polymerase attaches to the promoter
Bottom - Opposite where the TATA box is found

Since we concluded no TATA box exists, second option makes the most sense.

C) Which direction is upstream (left or right)?

Right - the promoter lies upstream of the transcription start site
Right - the promoter lies downstream of the transcription start site
Left - the promoter lies upstream of the transcription start site
Left - the promoter lies downstream of the transcription start site
New Topic      
Explore
Post your homework questions and get free online help from our incredible volunteers
  1278 People Browsing
Related Images
  
 19
  
 287
  
 807