Top Posters
Since Sunday
12
2
1
1
New Topic  
WalkerS WalkerS
wrote...
Posts: 6
Rep: 0 0
4 years ago
1.   Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation.

 Also write out the corresponding RNA sequence:
AGTAAACGTACCTGAGACGGG


2.   Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
Read 444 times
3 Replies
WalkerS*
Replies
Answer verified by a subject expert
bolbolbolbol
wrote...
Staff Member
Top Poster
Posts: 2886
4 years ago
Sign in or Sign up in seconds to unlock everything for free
Qn 1

Point mutation - only one base changes in a DNA sequence

AGTAGACATACCTGAGACGGG

In the above sequence the A has been changed into the bolded G



correspoding RNA sequence:

UCAUCUGUAUGGACUCUGCCC




Qn 2

Frameshift mutation- A base is added or deleted to a DNA sequence
\
GTAAACATACCTGAGACGGG

In the above sequence the first A was deleted from the DNA sequence



corresponding RNA sequence


CAUUUGUAUGGACUCUGCCC

2 Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes


Explanation:
In Prokaryotes the gene expression mainly is controlled at the level of transcription while the Eukaryotic gene expression is controlled at the levels of epigenetics, transcription, post-transcription, translation, and post-translation.

Prokaryotic gene expression occurs within the cytoplasm of a cell due to the lack of a defined nucleus; thus, the DNA is freely located within the cytoplasm while the Eukaryotic gene expression occurs in both the nucleus and cytoplasm.

In prokaryotes gene expression translation and transcription may occur at the same time while for the Eukaryotic transcription and translation are physically separated so the regulatory mechanisms must differ from those in bacteria

The Prokaryotic genes are regulated by operons while Eukaryotic genes are NOT regulated by operons.

The prokaryotes are organized in operons and transcribed by a single mRNA while for the Eukaryotic each structural gene has its own promoter and is transcribed independently.

During gene expression the prokaryotes have to respond quickly to changes in their environment while for the eukaryotes they transcription requires unwinding of the DNA form the histone proteins

REFERENCE

Gene regulation. (2017). Projects.ncsu.edu. Retrieved 16 July 2017, from http://projects.ncsu.edu/project/bio183de/Black/genereg/genereg.html
This verified answer contains over 360 words and 1 attached file(s).
Attached file
You must login or register to gain access to this attachment.

Related Topics

wrote...
2 years ago Edited: 2 years ago, Caitlyn Rose Morrow
thank you
Post Merge: 2 years ago

thank you
wrote...
A year ago
Thank You:)
New Topic      
Explore
Post your homework questions and get free online help from our incredible volunteers
  223 People Browsing
 158 Signed Up Today
Related Images
  
 174
  
 86
  
 71
Your Opinion
What percentage of nature vs. nurture dictates human intelligence?
Votes: 327

Previous poll results: Where do you get your textbooks?