General Biology

how our skin & mucous membranes function as componenents of body's first line

how our skin & mucous membranes function as componenents of body's first line

Describe how our skin & mucous membranes function as components of the body   First line of defense in innate immunity process?

HeiraKh   3308   1 Reply

bio_man

how the interaction between giraffe and acacia tree can be a predator–prey relationship

how the interaction between giraffe and acacia tree can be a predator–prey relationship

20. Giraffes are herbivores found in Africa. They prefer to eat twigs and leaves from acacia trees. This type of producer–consumer relationship can be described as a predator–prey relationship or parasitism.

Explain
1. how the intera

cannie248   2098   1 Reply

bio_man

identify whether the stage is haploid or diploid, and indicate the number of chromosomes that would

identify whether the stage is haploid or diploid, and indicate the number of chromosomes that would

The conifer plant has 12 chromosomes. For each of the four stages on the diagram of the conifer life cycle, labelled A-D, identify whether the stage is haploid or diploid, and indicate the number of chromosomes that would be found in the cells at eac

CANZ247   556   4 Replies

My Junk Mail Account

If a mutation appears in one individual that changes one base in a DNA sequence to another base, ...

If a mutation appears in one individual that changes one base in a DNA sequence to another base, ...

Q1. If a mutation appears in one individual that changes one base in a DNA sequence to another base, and the population is evolving by genetic drift, over time that mutation will:


a) Always take over and displace the old sequence.

Beren   698   2 Replies

bio_man

In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the d

In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the d

In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the dominant allele eb+. Vestigal wings are produced by the recessive allele vg and long wings by the dominant allele vg+.

When mated, a female w

mishaaus   1219   N/A

mishaaus

In the highest level of the affective domain

In the highest level of the affective domain

In the highest level of the affective domain, students are expected to
   A) adopt, and act consistently with, a new value.
   B) be aware of how other people feel.
   C) demonstrate an overt response to an idea or

Michellen29   580   1 Reply

bio_man

Interactions among chromosomes

Interactions among chromosomes

I am not exactly sure what to plug in.

asianadam   1095   5 Replies

Nemo131

Is it true or false ?

Is it true or false ?

Classification of prokaryotes is done currently by sequencing mRNA

wang   85   1 Reply

bio_man

Is it true or false ?

Is it true or false ?

Germ line tissues are usually induced by  interaction between somatic cells.

wang   55   1 Reply

bio_man

Is this sentence an example of correlation between scructure and function?

Is this sentence an example of correlation between scructure and function?

"Anthocyanins protect the leaf from sunlight as it pushes its own precious chemical resources back into twigs and branches before sacrificing itself." Can this sentence be a example of Correlation between Scructure and Function ?
or ex

aliaria   165   1 Reply

zxd

kidney stones

kidney stones

can excess calcium cause kidney stones

henry   573   1 Reply

genetix

Lab 2: Under What Conditions Do Cells Gain or Lose Water?

Lab 2: Under What Conditions Do Cells Gain or Lose Water?

Lab Results: (9 pts)
   Hypotonic solution   Isotonic solution   Hypertonic solution
Red Blood Cell:
Net water movement
(in /out)         
Red Blood Cell:
Appearance of Cell         
Elodea:
Net water movement
(in/out)         

kunoichi   8031   1 Reply

kawbdt

List the defining evolutionary adaptations or characteristics of each

List the defining evolutionary adaptations or characteristics of each

List the defining evolutionary adaptations or characteristics of each of following key lineages of protists. Limit your response to 1-2 key evolutionary synapomorphies.

Amoebozoa   
Excavata
Plantae
Rhizaria

lala b   783   1 Reply

duddy

Mechanism of action of drugs that affect the nervous system?

Mechanism of action of drugs that affect the nervous system?

Which of the following is a mechanism of action of drugs that affect the nervous system?

A.) encouraging binding of neurotransmitter to receptors on neurons within the brain
B.) blocking the addition of serotonin from synapses
C

cmeister703   1324   1 Reply

Doctor-2-B

Mendel's law of inheritance ---- Homework questions

Mendel's law of inheritance ---- Homework questions

Please help me with these homework questions.. Thanks

1. Consider a cross between a pea plant that is heterozygous for round seeds and a pea plant that has wrinkled seeds. The allele for round seeds (R) is dominant over that for wrinkled s

sweetangel   1895   4 Replies

sweetangel

mineral zinc effective as a possible emergency treatment for deadly australian box jellyfish stings

mineral zinc effective as a possible emergency treatment for deadly australian box jellyfish stings

 mineral zinc effective as a possible emergency treatment for deadly australian box jellyfish stings?

supertwitch   505   1 Reply

habiba

Modifications of histone tails can:

Modifications of histone tails can:

    Modifications of histone tails can:
    
   activate transcription of some genes.
   All of these choices are correct.
   affect chromatin structure.
   repress transcription of some genes.
   affect expression of some genes in re

pado   107   1 Reply

bio_man

NURSING

NURSING

I need question bank for : nursing a concept based approach to learning. ASAP!

nursem   588   N/A

nursem

PArental Genotype

PArental Genotype

Two pure-breeding wheat strains, one producing dark red kernels and the other producing white kernels, are crossed to produce F1 with pink kernel color. When an F1 plant is self-fertilized and its seed collected and planted, the resulting F2 consist

davis.tasha92   2642   5 Replies

happybunny98

Part E Using BLAST: Can You Identify a Pathogen from a Nucleotide Sequence?

Part E Using BLAST: Can You Identify a Pathogen from a Nucleotide Sequence?

Part E - Identify a common characteristic of your hit sequences
14.   Go back to the results page and scroll to the Descriptions section.
By examining the information in the Description column of the Descriptions section, it should be clear t

geri0108   1088   1 Reply

bio_man

physioEx 18B.

physioEx 18B.

I need the answers to #5 for physioEx 18B. Also #8, 10 and 12. thank you!

leah1690   1102   1 Reply

bio_man

Piston is a______ part of IC engine. a) Rotating b) Revolting c) Reciprocating d) Oscillating

Piston is a______ part of IC engine. a) Rotating b) Revolting c) Reciprocating d) Oscillating

 Piston is a______ part of IC engine.
a) Rotating
b) Revolting
c) Reciprocating
d) Oscillating

samuel ofosu   98   1 Reply

Anonymous

Probability and Genetics Lab

Probability and Genetics Lab

 Probability and Genetics Lab Report---
Has anyone done this lab before?? HELP




Based on the parents' genotypes, what is the genotypic ratio expected from a monohybrid cross between the two parents for the trait?

BeautifulOne   3972   N/A

BeautifulOne

Processes occurring at a bacterial replication fork?

Processes occurring at a bacterial replication fork?

Not understanding the processes occurring, any body have an strategies to remembering?

Lexilee   996   1 Reply

bio_man

Processes that determine heredity and contribute to genetic variation

Processes that determine heredity and contribute to genetic variation

Meiosis guarantees that in a sexual life cycle, offspring will inherit one complete set of chromosomes (and their associated genes and traits) from each parent. The transmission of traits from parents to offspring is called heredity.

Anoth

esmekittie   5634   1 Reply

nite_n_day

Provide and describe an analogies for Cellular Respiration and Photosynthesis

Provide and describe an analogies for Cellular Respiration and Photosynthesis

 Provide and describe an analogies for Cellular Respiration and Photosynthesis i need some help please guise its due in 55 mins =[

milesperez   3479   1 Reply

savio

Proximal tubule and "3 for the price of 1."

Proximal tubule and "3 for the price of 1."

In terms of energy costs to the cells in the proximal tubule, the reabsorption of salt (Na+ and Cl–) and water has been called a deal where we get “3 for the price of 1.” Explain.

SpiritWolf   382   2 Replies

SpiritWolf

Rank the likely abundance of fossils of organisms A–E?

Rank the likely abundance of fossils of organisms A–E?

Any help would be helpful!

ANMOORE   968   2 Replies

ennraii

regressive evolution

regressive evolution

Hi:) could anyone explain how regressive evolution works?
I understand progressive evolution- organisms with favourable characteristics in a given environment are more likely to survive and pass on their genes. But i don’t understand how a speci

Marie969   82   1 Reply

my2redeyes

Select the main ideas expressed in Darwin's publication On the Origin of Speci

Select the main ideas expressed in Darwin's publication On the Origin of Speci

Question 1:
Select the main ideas expressed in Darwin's publication On the Origin of Species?
A) Plants and animals produce more offspring than will be able to survive.
B) Present forms of life have arisen by decent and modificati

kim44   661   1 Reply

bio_man

sequence of nucleotides

sequence of nucleotides

The following sequence of nucleotides is found in a single-stranded DNA template:

AGCATACAGCAGACCGTTGGTCTGAAAAA AGCATACA

A) Assume that RNA polymerase proceeds along this template from left to right. Which

Anonymous   161   1 Reply

Anonymous

Spermatogenesis is the process of male gamete (sperm) production in animals.

Spermatogenesis is the process of male gamete (sperm) production in animals.

Oogenesis is the process of female gamete (ovum or egg) production in animals. Spermatogenesis is the process of male gamete (sperm) production in animals.

Provide two major differences between the processes of oogenesis and spermatogenes

CANZ247   217   1 Reply

bolbol

Table 1: Threshold Stimulus (V) Muscle Stimulation AMU SCIN 130

Table 1: Threshold Stimulus (V) Muscle Stimulation AMU SCIN 130

Need assistance on that please...

mallwood5   6673   5 Replies

how_mendel

The 30,000 elephant seals alive today are genetically very similar due to The

The 30,000 elephant seals alive today are genetically very similar due to The

 The 30,000 elephant seals alive today are genetically very similar due to
The 30,000 elephant seals alive today are genetically very similar due to
   A.random mutation.
   B.natural selection.
   C.artificial selection.
   D.the bo

ruru618   1922   1 Reply

padre

The excretory organ in Platyhelminthes is known as.........................

The excretory organ in Platyhelminthes is known as.........................

The excretory organ in Platyhelminthes is known as........................... .............

adeymola   880   1 Reply

bio_man

The proposal that a human sperm contained a miniature human being is consistent

The proposal that a human sperm contained a miniature human being is consistent

 The proposal that a human sperm contained a miniature human being is consistent with the
now-discredited theory of development known a

jojoe2005   1866   1 Reply

bio_man

The suprachiasmatic nucleus controls circadian rhythms via

The suprachiasmatic nucleus controls circadian rhythms via

 
   
a) indirect neural connections with the hippocampus.
 
   
b) release of hormones from the pituitary.
 
   
c) activation of the ganglion cells of the retina.
 
   

taramochrie   417   2 Replies

taramochrie

theoretical populations question.

theoretical populations question.

Been stuck on these questions for a long time.

haikal94   237   1 Reply

padre

two main experiments that disproved the concept of spontaneous generation

two main experiments that disproved the concept of spontaneous generation

Can someone help?
Thank you in advance.

Describe the two main experiments that disproved the concept of spontaneous generation. Give details as to why these experiments were effective in disproving this idea.

mihaella   2691   2 Replies

f_zah1

Virtual Lab: Enzyme Controlled Reactions

Virtual Lab: Enzyme Controlled Reactions

Virtual Lab:  Enzyme Controlled Reactions Answers
 

Okah31   25433   7 Replies

Kathryn Dick