Biochemistry

13 years ago

Michaelis-Menton & Lineweave Burk

So I have a set of data that I have graphed. There is a velocity value in mM-1 s-1 and substrate concentration value in mM. Then I also have a velocity inhibitors 1-3.
So for this data that I have graphed how will i determine if it inhibits enz

swimmer052005 662 2 Replies

13 years ago

Proteases

What is the reason that some proteases have multiple substrates?

How would you determine which protease out of multiple ones is the best overall?

swimmer052005 491 1 Reply

13 years ago

Translation on ribosome

Below is a depiction of a ribosome in the process of translation. Redraw the figure, correct the wrongs and explain what is wrong. Name the three sites related to translation on ribosome.

minjai0322 1100 1 Reply

13 years ago

Double stranded DNA sequence

Shown below is a double stranded DNA sequence for a bacterial protein. Only one protein is coded for in this segment of DNA.

i. 5’ ACTAGGCGATGCGAAGCAAGGTGGCC …
ii. 3’ TGATCCGCTACGCTTCGTCCATCGG …

(b) Indicate which strand is

minjai0322 2222 1 Reply

13 years ago

Shown below is a diagram of the first cycle of PCR to amplify a segment of DNA using a pair of prime

Shown below is a diagram of the first cycle of PCR to amplify a segment of DNA using a pair of primers. The three steps are carried out at 95°C, 50°C and 70°C, respectively.
a. Assign those three temperatures to the three steps shown below.

minjai0322 2017 1 Reply

13 years ago

Multople Choice Questions for Translation

1. How many start codons are in the universal code?
(a) 1
(b) 2
(c) 3
(d) 4
(e) none of the above

2. What is the size of the eukaroytic 40S and 60S complex?
(a) 20S
(b) 80S
(c) 100S
(d) 24

minjai0322 1037 3 Replies

13 years ago

pH gradient across Membranes

Following is a diagram of the first experiment demonstrating that pH gradient and proton flow is related to ADP -> ATP conversion. F0F1 units on membrane vesicles are isolated. Then it was soaked in a solution with pH A. After the pH inside the ve

minjai0322 730 1 Reply

13 years ago

The sequence of Recombinant DNA

You have an unknown sequence 5’-AGA__CC_AG__-3’, where the ____ represent gaps of unknown length. The known bases are not the location of the restriction sites. This sequence is digested with ScaI, PvuII and SnaBI individually, yielding the restricti

minjai0322 1105 3 Replies

13 years ago

Spliceosome

I don't really understand about the topic spliceosome in my biochem book. Can anyone explain it to me?

so I came by this question that I have no clue...

Which of the following are true about mRNA splicing?

-One m

jamie33 1280 1 Reply

13 years ago

We know that glucose molecules are subtracted and added from the non-reducing...

We know that glucose molecules are subtracted and added from the non reducing ends of glycogen, but why do so many ends exist?

swimmer052005 796 1 Reply

13 years ago

Membrane Proteins

You come across a membrane protein that has been determined to be involved with the passive transport process.
A gene has been identified for the protein however you are unable to develop any structural information about this protein by crystal

swimmer052005 892 N/A

swimmer052005

13 years ago

Cell Membrane Associated hormone Receptors

In the progress of performing an experiment, we find that (briefly) washing cells in a buffered solution at pH 3 is effective for isolating a cell membrane associated hormone receptor. (A std growth soln for the cells is usually pH 7).

swimmer052005 693 1 Reply

13 years ago

What are the intermediates of the cholesterol synthesis? What do they mean?

What are the intermediates of the cholesterol synthesis? What do they mean? isnt it from acetyl CoA to mevalonate?

jamie33 662 1 Reply

13 years ago

VLDL, LDL, HDL, etc

Scavenging cholesterol from cell membranes is HDL
Transporting of lipids from liver to tisse is VLDL
Transporting of cholesterol esters to the liver is what?

What about the functions of chylomicron, IDL, and LDL if it's not

lisa142 834 1 Reply

13 years ago

Membrane Protein and primary sequence

You come across a membrane protein that has been determined to be involved with the passive transport process. A gene has been identified for the protein however you are unable to develop any structural information about this protein by crystallograp

swimmer052005 840 1 Reply

13 years ago

Transamination

Which of the following is a alpha-keto acid/alpha -amino acid pair in transamination?

-pyruvate/leucine
-oxaloacetate/aspartate
-oxaloacetate/glutamate
-alpha-ketoglutarate/aspartate
-alpha-keto beta -hydroxylbutyrate/p

lisa142 1752 2 Replies

13 years ago

Negative supercoiling

...which of these are correct?

Negative supercoiled DNA has more helical turns than relaxed DNA.
Negative supercoiling occurs as a result of the underwinding of circular or protein-bound DNA.
Negative and positive supercoiling gi

jamie33 13648 12 Replies

13 years ago

Reducing ends

You discover a molecule of glycogen that consists of approximately 1000 glucose residues and has branches every 10 residues.

Determine the number of possible non reducing ends there can be.

Is this

swimmer052005 4806 5 Replies

13 years ago

Ion Channel operations

When the channel is open, what provides the driving force for ion transport ?

Is this in any way correct or am I missing a few things?

Open ion channels provoke rapid responses. Ions are driven though channels by the sum of thei

swimmer052005 970 1 Reply

13 years ago

A mechanism of the HCO3-

We discussed acidification of the stomach by pumping protons. The
acidic fluid from the stomach needs to be neutralized in the intestine. This is
done by the pancreas juice secreted in the pancreas and flowing into the
intestine. A mec

minjai0322 1556 1 Reply

13 years ago

What is the difference between a Type I and Type II FAS?

What is the difference between a Type I and Type II FAS Question Mark

biolove 814 1 Reply

13 years ago

Explain the sequence of events that occurs when epinephrine triggers the synt

Explain the sequence of events that occurs when epinephrine triggers the synthesis of cAMP.

biolove 1190 2 Replies

biolove

13 years ago

What are polyketides? Give one example.

What are polyketides? Give an example.

biolove 1805 2 Replies

biolove

13 years ago

Why is the chorismate pathway a target for herbicide development?

Why is the chorismate pathway a target for herbicide development Question Mark

biolove 789 2 Replies

biolove

13 years ago

How many Ca2+ binding sites does calmodulin have?

How many Ca2+ binding sites does calmodulin have Question Mark

biolove 1661 2 Replies

13 years ago

What is leghemoglobin?

What is leghemoglobin Question Mark

biolove 4190 2 Replies

13 years ago

Different hemoglobion in before and after metamorphosis?

Why do many creatures (such as frogs, toads, flatfish) have different types of hemoglobin between their post- and pre-metamorphic states? i.e. What is the biological reason (any advantage to the organism), more than how it works. Thanks!

lrob 1130 3 Replies

13 years ago

Explain the metabolic relationship between haemoglobin synthesis and folic acid

Explain the metabolic relationship between haemoglobin synthesis and folic acid deficiency.

bio_man 3057 1 Reply

13 years ago

Suppose you are stranded on a deserted island and have nothing but protein to

Suppose you are stranded on a deserted island and have nothing but protein to eat. Briefly outline how your body will use this source of food for its energy needs.

bio_man 2903 1 Reply

13 years ago

Why does the brain use ketone bodies as metabolic fuel during starvation when th

Why does the brain use ketone bodies as metabolic fuel during starvation when there are abundant fatty acids available from the blood?

bio_man 4740 1 Reply

13 years ago

McArdle disease

The first patient described to have McArdle disease (type V glycogen storage disease), was a young man who was weak and developed severe muscle pain on doing modest exercise. A biopsy of his muscle showed accumulation of glycogen, and enzyme assays r

bio_man 825 1 Reply

13 years ago

Explain how carbon flux through the pentose phosphate pathway is regulated.

bio_man 1746 1 Reply

13 years ago

PCR

I am asked to work out the size of the product of a PCR reaction, I am not sure how to do this and I would appreciate any help- if its quite a long process, then I would appreciate any guidelines on how to do this.

I have two primers- a f

lrob 5039 3 Replies

13 years ago

emulsion PCR

Hello! Does anyone know how emulsion PCR (or emPCR) works, and what is it used for? I think it is performed after pyrosequencing, but I don't know why- woulndn't regular PCR do the same? This PCR type doesn't seem to have much written

lrob 13526 1 Reply

13 years ago

How is DNA Sequencing Done ? Please help !!?

How is DNA Sequencing Done ? Please help !!?
1-)What is the overall charge for the following polypeptide sequence if you assume 100% ionisation (and a charge of +1 or -1) for the basic and acidic amino acids?

ADGRKKLIFGRGTRNMQAGSATLE

Korsanx2 1493 2 Replies

13 years ago

How to calculate the # of ATPs

How do you calculate the # of ATPs for a C16?
I know there's an equation but somehow when I'm calculating it, I'm not getting the right answer.

This is what I did:
C16-even C# so (n/2)=5 acetyl -SCoA
&n

1 2

alatq33 32094 14 Replies

13 years ago

Carbonic Anhydrase Question Help

Hey guys! I'm so thankful I found this forum. I've been using it a lot and all of you are all so intelligent.

I was just wondering if any of you could help me with a question. The question is as followed:

Carbon

beauknows 4307 6 Replies