Biochemistry

13 years ago

photosynthesis rxn

3 ________+ 3 ATP -> 3 ___________+ 3 ADP

6 _______+ 6ATP -> 6___________ + 6ADP

choose from:

1,3 -biphosphoglycerate
3- phosphoglcerate
erythrose-4-phosphate
glyceraldehyde-3-ph

chels194 843 1 Reply

13 years ago

calvin cycle

So I'm sure what belongs in the empty box. It's either glyceraldehyde-3-phosphate or fructose-6-phosphate. I think I have the rest correct?

chels194 727 1 Reply

13 years ago

Amino acids

Can anyone name give me a list of all the amino acids and its precursors. I need to know this for my test. Slight Smile

chels194 817 1 Reply

13 years ago

Transcriptional Regulation Problem

A strong promoter in E. coli is used by RNA polymerase to initiate transcription every 4 seconds. The degradation rate constant of the transcript is 0.004 sec-1. What is the number of mRNA per cell at steady state? Neglect dilution due to cell growth

minjai0322 696 1 Reply

13 years ago

M13 Bacteriophage

I understand that M13 bacteriophage has been genetically modified to not undergo lytic phase. However, there is one part I dont understand. Why is it that the phage is able to reduce stop codons incorporation by having a fomula of NN(G/T) in its olig

lalala 1084 1 Reply

13 years ago

What kind of detergent is that

As seen in the picture, what is the answer?

lalala 889 1 Reply

13 years ago

What is the metabolic relationship between haemoglobin synthesis and folic acid

Folic acid deficiency, believed to be the most common vitamin deficiency, causes a type of anemia in which haemoglobin synthesis is impaired and erythrocytes do not mature properly. What is the metabolic relationship between haemoglobin synthesis and

biolove 6643 1 Reply

13 years ago

Suppose that a person is found who is deficient in an enzyme required for IMP

Suppose that a person is found who is deficient in an enzyme required for IMP synthesis. How might this person be treated?

biolove 885 1 Reply

13 years ago

Lesch-Nyhan syndrome is a disease caused by severe deficiency in HPRT activit

Lesch-Nyhan syndrome is a disease caused by severe deficiency in HPRT activity. In the absence of HPRT, hypoxanthine and guanine are not converted to IMP and GMP, respectively, in the salvage reactions. The disease is characterized by the accumulatio

biolove 942 1 Reply

13 years ago

Explain how 5-fluorouracil combats some types of cancer.

Explain how 5-fluorouracil combats some types of cancer.

Thanks!

biolove 935 1 Reply

13 years ago

Why might multifunctional enzymes such as those of the pyrimidine

Why might multifunctional enzymes such as those of the pyrimidine biosynthetic pathway of mammals be advantageous to an organism?

Thanks!

biolove 666 1 Reply

13 years ago

alanine-glucose cycle with that of the Cori cycl

Compare the function of the alanine-glucose cycle with that of the Cori cycle. Under what circumstances might each operate?

mikael 7281 1 Reply

13 years ago

Recombinant Expresion & Protein Production

Recombinant expression of many mammalian proteins requires production of the
protein at below physiological temperatures (i.e. below 37 °C). If the protein is
expressed at 37 °C, all you produce is a large mass of aggregated protein called

swimmer052005 656 1 Reply

13 years ago

Chymotryptsin Mutations

Based on your knowledge of the enzyme chymotrypsin, what effect would you
predict for the following mutations? Predict the correct event for each mutations and provide a clear justification.
a. His-57 to Lys
b. Asp-102 to Glu
c.

swimmer052005 641 1 Reply

13 years ago

Michaelis-Menton & Lineweave Burk

You are screening a series of possible enzyme inhibitors. For each set of data,
determine if this compound inhibits enzyme function and what type of
inhibition is shown. You will get points for including graphs of all three
sets of dat

swimmer052005 989 1 Reply

13 years ago

Neuroscience vs. Biochemistry?

Im in second year of biological sciences and in 3rd year i have to specialise in either Neuro or Biochem. I think I would be a lot more interested in Neuro but i think the biochem would be a bit more useful? I dunno whether to go with what I like or

sofia 3782 1 Reply

13 years ago

Forensic Science after MSc in Biochemistry ?

I have completed MSc in biochemistry , am interested in forensic science, can you please guide me to what courses or training will be best suited to help me enter the field.

sofia 2022 1 Reply

ThePsychic

13 years ago

Chymotryptsin Mutation Effects

Based on your knowledge of the enzyme chymotrypsin, what effect would you predict for the following mutations? You must predict the effect of each mutation and then provide a clear justification.

a. His57 to Lys
b. Asp102 to Glu

swimmer052005 812 1 Reply

13 years ago

Proteases

What is the reason that some proteases have multiple substrates?

How would you determine which protease out of multiple ones is the best overall?

swimmer052005 491 1 Reply

13 years ago

Translation on ribosome

Below is a depiction of a ribosome in the process of translation. Redraw the figure, correct the wrongs and explain what is wrong. Name the three sites related to translation on ribosome.

minjai0322 1101 1 Reply

13 years ago

Double stranded DNA sequence

Shown below is a double stranded DNA sequence for a bacterial protein. Only one protein is coded for in this segment of DNA.

i. 5’ ACTAGGCGATGCGAAGCAAGGTGGCC …
ii. 3’ TGATCCGCTACGCTTCGTCCATCGG …

(b) Indicate which strand is

minjai0322 2222 1 Reply

13 years ago

Shown below is a diagram of the first cycle of PCR to amplify a segment of DNA using a pair of prime

Shown below is a diagram of the first cycle of PCR to amplify a segment of DNA using a pair of primers. The three steps are carried out at 95°C, 50°C and 70°C, respectively.
a. Assign those three temperatures to the three steps shown below.

minjai0322 2018 1 Reply

13 years ago

pH gradient across Membranes

Following is a diagram of the first experiment demonstrating that pH gradient and proton flow is related to ADP -> ATP conversion. F0F1 units on membrane vesicles are isolated. Then it was soaked in a solution with pH A. After the pH inside the ve

minjai0322 731 1 Reply

13 years ago

Spliceosome

I don't really understand about the topic spliceosome in my biochem book. Can anyone explain it to me?

so I came by this question that I have no clue...

Which of the following are true about mRNA splicing?

-One m

jamie33 1280 1 Reply

13 years ago

We know that glucose molecules are subtracted and added from the non-reducing...

We know that glucose molecules are subtracted and added from the non reducing ends of glycogen, but why do so many ends exist?

swimmer052005 796 1 Reply

13 years ago

Cell Membrane Associated hormone Receptors

In the progress of performing an experiment, we find that (briefly) washing cells in a buffered solution at pH 3 is effective for isolating a cell membrane associated hormone receptor. (A std growth soln for the cells is usually pH 7).

swimmer052005 693 1 Reply

13 years ago

What are the intermediates of the cholesterol synthesis? What do they mean?

What are the intermediates of the cholesterol synthesis? What do they mean? isnt it from acetyl CoA to mevalonate?

jamie33 663 1 Reply

13 years ago

VLDL, LDL, HDL, etc

Scavenging cholesterol from cell membranes is HDL
Transporting of lipids from liver to tisse is VLDL
Transporting of cholesterol esters to the liver is what?

What about the functions of chylomicron, IDL, and LDL if it's not

lisa142 835 1 Reply

13 years ago

Membrane Protein and primary sequence

You come across a membrane protein that has been determined to be involved with the passive transport process. A gene has been identified for the protein however you are unable to develop any structural information about this protein by crystallograp

swimmer052005 840 1 Reply

13 years ago

Ion Channel operations

When the channel is open, what provides the driving force for ion transport ?

Is this in any way correct or am I missing a few things?

Open ion channels provoke rapid responses. Ions are driven though channels by the sum of thei

swimmer052005 971 1 Reply

13 years ago

A mechanism of the HCO3-

We discussed acidification of the stomach by pumping protons. The
acidic fluid from the stomach needs to be neutralized in the intestine. This is
done by the pancreas juice secreted in the pancreas and flowing into the
intestine. A mec

minjai0322 1556 1 Reply

13 years ago

What is the difference between a Type I and Type II FAS?

What is the difference between a Type I and Type II FAS Question Mark

biolove 814 1 Reply

13 years ago

Explain how carbon flux through the pentose phosphate pathway is regulated.

bio_man 1747 1 Reply

13 years ago

McArdle disease

The first patient described to have McArdle disease (type V glycogen storage disease), was a young man who was weak and developed severe muscle pain on doing modest exercise. A biopsy of his muscle showed accumulation of glycogen, and enzyme assays r

bio_man 825 1 Reply

13 years ago

Why does the brain use ketone bodies as metabolic fuel during starvation when th

Why does the brain use ketone bodies as metabolic fuel during starvation when there are abundant fatty acids available from the blood?

bio_man 4740 1 Reply

13 years ago

Suppose you are stranded on a deserted island and have nothing but protein to

Suppose you are stranded on a deserted island and have nothing but protein to eat. Briefly outline how your body will use this source of food for its energy needs.

bio_man 2903 1 Reply

13 years ago

Explain the metabolic relationship between haemoglobin synthesis and folic acid

Explain the metabolic relationship between haemoglobin synthesis and folic acid deficiency.

bio_man 3058 1 Reply

13 years ago

emulsion PCR

Hello! Does anyone know how emulsion PCR (or emPCR) works, and what is it used for? I think it is performed after pyrosequencing, but I don't know why- woulndn't regular PCR do the same? This PCR type doesn't seem to have much written

lrob 13526 1 Reply

13 years ago

ok so unknown stuff help :)

1.if unknown to you, your pipet was incorrectly calibrated so that it transferred less then 10 ml of solution, the density you calculated for the liquid would tend to be____( larger/smaller) than the corect value. Explain

2. the density of

gh1991 4768 1 Reply