× Didn't find what you were looking for? Ask a question
Top Posters
Since Sunday
Home Q & A Board Biology-Related Homework Help General Biology
New Topic  
Emily52196 Emily52196
wrote...
Posts: 4
Rep: 0 0
9 years ago
----------------3' CCGTTTG 5'
5' ACTCATGGGCAAACGCATTAG 3'

16) What would be produced if DNA polymerase
and nucleotides were added to the DNA
molecule shown above?
A) 5' ACTCATG 3'
B) 3' CCGTTTG 5'
C) 3' TGAGTAC 5'
D) 3' CGTAATC 5'
E) 5' GCATTAG 3'

Can someone answer this and tell me why its the answer? Thanks!
Ignore the -----. I just put them in there to match up the sequences like they are in the question.
Read 969 times
3 Replies

Related Topics

Replies
wrote...
#1
Educator
9 years ago
Quote from: Emily52196 (9 years ago)
C) 3' TGAGTAC 5'

Because of the pairing rules, A goes with T, and C goes with G.
Emily52196 Author
wrote...
#2
9 years ago
So the DNA being added comes before the 3' end of the top strand? I thought DNA would be added to the other side of the top strand because I thought DNA was added, during replication in the 3'->5' diection
wrote...
#3
Educator
8 years ago
Here's a better look:
New Topic      
Quick Reply
Explore
Post your homework questions and get free online help from our incredible volunteers
  1239 People Browsing
Start New Topic Take the Tour CoursesNew Study Tools Topics Trending Browse by Textbook
Live Chat
Related Images
  
 236
  
 201
  
 148
Your Opinion
Previous poll results: Who will win the 2024 president election?