In SDSpolyacrylamide gel electrophoresis proteins are partially denatured and separated entirely as a function of their mass.
Histones are an exception; they migrate more slowly than they should, as though they are much larger than they actually are. Why does this occur?
A. Histones form dimers and tetramers, making them appear larger.
B. Histones are heavily glycosylated, greatly adding to their mass.
C. Histones have a large number of positively charged amino acid residues. The binding of SDS to the histones is not sufficient to mask these charges, resulting in slower migration.
D. Histones have an affinity for polyacrylamide.
E. Histones are somewhat insoluble, which slows their passage through the gel.
What technical advance made it possible to crystallize DNA?
What will be an ideal response?
The C-terminal region of the herpes virus structural protein VP16 transcriptional activation domain was fused to the DNA-binding domain of LexA protein to create a VP16-LexA chimaera.
The new gene encoding the VP16-LexA fusion protein was inserted into a plasmid and transferred to yeast, along with a plasmid that contained theGAL1 gene promoter fused to the bacterial -galactosidasegene, lacZ. This is experiment A. The new gene encoding the VP16-LexA fusion protein was inserted into a plasmid and transferred to yeast, along with a plasmid that contained theGAL1 gene promoter containing a LexA binding site fused to the bacterial -galactosidasegene, lacZ. This is experiment B. Which of the following graphs correctly show the expected levels of GAL1-lacZ fusion gene expression?
The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification.
ATGAAAGCAATTTCCGTACTGAAAGGTTG
GTGGCGCACTTCCTGA wild type leader peptide
coding sequence
ATGAAAGCAATTTCCGTACTGAAAGGTGG
GTGGCGCACTTCCTGA mutant leader peptide
coding sequence
What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type?
A. The Trp repressor will bind more tightly to the trp operon in the mutant cells.
B. The amount of attenuation will be reduced in the mutant.
C. Negative control of the trp operon will be increased in the mutant.
D. Open promoter complexes will form less often in the mutant.
Which of the following type of reaction is not involved in the spliceosome-mediated pre-mRNA splicing?
A. ligation
B. deamination
C. transesterification
D. phosphodiester bond cleavage
Quick Reply
