DNA primers and sequencing question

The E. coli genome is 4,600,00 base pairs (b.p.) long.  If you wished to design a DNA primer that was likely to recognize 1 and only 1 part of the genome, how many base pairs long would it need to be?
 
5' - TTACTAACCGGATTACCAATTACATTAACCAACA TTAGGACTTATTACCTAGGACCTACGTC - 3'

Above you will see a single strand of DNA which was obtained by sequencing the genome of a bacterium.  If you wanted to make copies of the bold section of the sequence using 5 b.p. long primers, which primers would you choose?  Clearly indicate the 5' and 3' ends of your primers.

I cannot figure out either part so if someone could guide me in the right direction as to how to solve. I have difficulty finding primers.