Transcript
Name: ____________________________________________________
Exam 1A: Foundations of Ecology and Evolution
Fall 2016
Multiple Choice (2 points each). Test has 129 points on it.
1. Which of the following is not usually used to support the Theory of Evolution?
A. presence of animals
B. ice core information
C. geology
D. the fossil record
E. molecular and developmental biology
2. Which of the following is the last step in Ernst Mayr’s Model of Allopatric Speciation?
A. A railroad track is laid through the middle of a population of salamanders.
B. Frog habitat is returned to the natural state and there is so much difference in the populations found there that they can no longer interbreed.
C. The level of the ocean falls and isolated crayfish in several locations.
D. There is no gene flow between two groups of black bears.
3. Which of the following is an example of sympatric speciation?
A. Two groups of salamanders are isolated by a shopping mall and the populations diverge.
B. Maggot flies hatch at varying times, causing them to lay eggs on two different fruits. Eventually there is no gene flow between these groups.
C. The Channel Island fox has diverged from foxes on the California mainland.
D. A group of crayfish living in the same area is separated when sea level falls.
4. A research group is examining plants that show a variation in height in two different environments. The plant labeled “Old Field Growth” comes from abandoned agricultural lands. Looking at the data they collected, make a prediction about what caused the difference in these plants from the same species.
Plant Type
Old Field Growth
Abandoned Urban Areas
Mean Height in Nature
36 cm
15 cm
Mean Height in Greenhouse
36 cm
15 cm
Flower Color
Purple
Yellow
DNA Segment of Height Gene
AATTCGCTTAATCGGGAATT
TTAACGCTTAATCGGGAATT
A. The plants are exhibiting acclimation.
B. The plants are exhibiting adaptations to the different environments.
C. The plants are ecotypes based on two microclimates.
D. There is no relationship between these plants.
E. All of these are true except D.
5. Which of the following is a facultative mutualism?
A. euglossine bee and orchid B. Pseudomyrmex ant and Acacia
C. Cercropia and Azteca ant D. rhino and rhino apple trees
6. What is the accepted date (currently) for the formation of the Earth?
A. 4.6 billion years B. 4.6 million years
C. 3.5 million years D. 3.5 billion years
Match the following scientists to their contributions on the theory of evolution.
Charles Darwin
Alfred Russel Wallace
Carolus Linnaeus
Jean Baptiste Lamarck
Charles Lyell
D 7. He took a great conceptual step and proposed a full-blown theory of evolution. It was called the Theory of Use and Disuse.
A 8. He proposed an entirely natural process, a process that was testable through scientific means, to explain the diversity of life around us. It was called evolution by natural selection.
C 9. He joined the quest for classification after having trained as a physician at the University of Uppsala and was the first to assign names to organisms.
B 10. He independently of Darwin conceived of a natural, even observable, way for life to change.
E 11. “Catastrophism” was attacked in 1830 by this British lawyer-turned-geologist.
12. The shapes of marine animals are similar across taxa as different as sharks and dolphins. What reason can you give for this difference?
A. convergent evolution B. evolutionary radiation C. phenotypic plasticity D. acclimation
13. What is the accepted date (currently) for the formation single cellular life on Earth?
A. 4.6 million years B. 4.6 billion years
C. 3.5 billion years D. 3.5 million years
14. Which of the following can adversely affect small populations?
A. genetic drift B. stochastic processes
C. the founder effect D. All of these.
15. The basic relationships that tie life together can be visualized using a(n):
A. web. B. phylogeny. C. bush. D. radial.
16. Evolution occurs at the level of the ___________, even though natural selection usually works at the level of the __________.
A. individual; community B. population; community
C. individual; population D. population; individual
17. If you condense the history of the Earth into 12 hours, how long have humans been on the planet?
A. About 2 seconds. B. About 2 hours.
C. About 10 minutes. D. About 10 hours.
Matching.
A. monogamy B. polyandry C. polygyny D. polygynandry
A 18. The best mating system for male dunnocks.
B 19. The best mating system for female dunnocks.
A 20. The most common mating system for humans.
D 21. A state of changing partners during each breeding season and also having multiple partners. This happens in many communal nesting birds.
22. The process of the plates on land, as well as in the sea, moving is called:
A. technology. B. continental drift. C. plate emotion. D. evolution.
23. Referring to the work of the Brodies on garter snakes and rough skinned lizards, which of the following are true?
A. When camping, always inspect your coffee pot for lizards.
B. There is a difference in resistance to TTX in snakes from different areas.
C. Snakes living with rough skinned newts had the most resistance to TTX, but not a constant amount.
D. It would be remarkably bad for you to ingest TTX.
E. All of these are true.
24. Which of the following is a definition of evolution?
A. A continuous process of change that produces a series of transformations.
B. Descent with modification.
C. A change in the gene frequency of a trait in a population or species from one generation to the next.
D. The descent of different species from a common ancestor over many generations.
E. All of these are definitions of some type of evolution.
Match the following scientists to their contributions on the theory of evolution.
Nicholas Steno
Rosalind Franklin
Georges-Louis LeClerc Comte de Buffon
Francis Crick and James Watson
Georges Cuvier
E 25. He joined the fledgling National Museum in Paris in 1795, and quickly became the world's leading expert on the anatomy of animals. He then used that knowledge to interpret fossils with unprecedented insight.
D 26. Responsible for the 1953 paper in Nature that described the structure of DNA.
A 27. He proposed that horizontal layers of rock represent a time sequence with the oldest layers on the bottom and the youngest on top, unless later processes disturbed this arrangement (Law of Superposition).
B 28. The Nobel Prize in 1963 should have been Watson, Crick and this person who took the actual X-ray crystallograph of DNA.
C 29. His career centered on a single enormous project: an encyclopedia he called Histoire Naturelle, which he planned to contain everything known in his day about the natural world.
30. In the study by Hoekstra et al. on old field and beach mouse populations of the same species, a single amino acid substitution is responsible for the white versus brown color morphs. Assume that the gene coding for brown color is dominant over the gene coding for white color, and that the population is in Hardy-Weinberg equilibrium. Now assume that we trap these mice and that our results reflect the true numbers of mice displaying brown versus white coats. If 4% of the mice have white coats, what is the frequency of q, the recessive allele?
A) 0.04 B) 0.32 C) 0.40 D) 0.20 E) 0.80
31. What, if anything, is the dog?
A. A subspecies of the grey wolf.
B. A subspecies of the coyote.
C. A subspecies of the grey hippopotamus.
D. None of these, the dog is a good species of its own.
32. Which of the following is the correct definition for a theory?
A. An educated guess.
B. A data set published in a journal.
C. A statement of general laws, principles or causes of something known or observed.
D. An idea put forth by people in a discipline as a working hypothesis.
33. The wild cabbage (Brassica olereacea) has been used to create many commercial vegetables. What is the process used by farmers for this purpose?
A. evolution B. artificial selection
C. evolution selection D. natural selection
34. A gene family is best described by which of the following?
A. A group of genes that work together.
B. A group of genes related due to a duplication event that work together.
C. The globin genes.
D. Both A and B.
E. All of the above.
35. Which of the following is a post zygotic barrier to species interbreeding?
A. Changes in call frequency in Rana species.
B. The fact that mules are sterile and other hybrids are not as viable.
C. Changes in color pattern in butterflies.
D. An incompatibility of the uterus and penis shapes of horses and cows.
36. A gene passes through a duplication event. After the event, several changes take place in the DNA sequence. Which of the following changes would be the most detrimental to the organism (and the gene)? Why?
A. A transition, because it changes a purine for a pyrimidine in the sequence.
B. A transversion, because it changes a purine for a pyrimidine in the sequence.
C. A transition, because it changes a purine for a purine in the sequence.
D. A transversion, because it changes a pyrimidine for a pyrimidine in the sequence.
Matching
A. sickle cell B. nonsense C. thalassemia D. point mutation E. hypercholesterolemia
D 37. The simplest type of DNA mutation.
A 38. A change in one base causing distortion in the shape of red blood cells.
E 39. A frame-shift mutation.
C 40. A nonsense mutation that causes a premature stop codon to appear in a hemoglobin gene.
B 41. A mutation that causes a gene to become nonfunctional or to be truncated prematurely.
42. About how long ago did the hominid called “Lucy” (Australopithicus afarensis) walk the Earth?
A. 6 million years B. 4 billion years
C. 4 million years D. 3 billion years
43. Which of the following have changed on the Earth through time?
A. oxygen concentration
B. carbon dioxide concentration
C. position of tectonic plates
D. levels of extinction
E. Actually, all of these have been different at different stages of the Earth’s history.
Problems and Short Answer.
(6) List the six assumptions of the Hardy-Weinberg Equilibrium.
No Mutations
No Natural Selection
Very Large Population
Random Mating (No Sexual Selection)
All Members of Population Have the Same Fertility and Mortality Rates or Same Evolutionary Fitness
No Immigration or Emigration
(8) List the four Darwinian postulates of evolution.
Variation exists within and between populations for any given trait (Variation arises through mutations).
The genetic traits of organisms are inherited from their parents.
Normally, many more individuals are produced than can survive.
The process of natural selection preserves the most fit.
(5) List the five mechanisms of evolution.
Natural selection = differential reproductive and survival of genotypes
Sexual Selection = individual males or females have some slight advantage over other males or females and have transmitted these advantages to their offspring
Mutation = novel mutations in the population
Gene flow or Migration and non-random mating = the net movement of alleles into or out of a population
Genetic Drift and Founder Effect
(3) Draw a figure illustrating a change in body size towards a larger bird. What is this process called? DIRECTIONAL SELECTION
0000
716280100965
Body Size
(3) Draw a figure illustrating the effect of two radically different food sizes on bird beaks. What is this process called? DISRUPTIVE SELECTION
194062-190500
Beak Size
(3) Draw a figure illustrating a change in human birth weight from the past until today. What is this process called? STABILIZING SELECTION
0000
Birth weight
(12) 47. Given the characteristics of the following population, answer the questions below and show your work.
AA = 50 Aa = 150 aa = 10
Given:
p + q = 1 p = AA + ½Aa q = aa + ½Aa
p2 + 2pq + q2 = 1 (p + q)2 = 1
X2 = [(observed - expected)2 / expected] X2 2, 0.05 = 6.00
A) What are the observed genotype frequencies?
AA = 50/210 = 0.23809 = 23.809%
Aa = 150/210 = 0.714285 = 71.4285%
aa = 10/210 = 0.047619 = 4.7619%
B) What are the observed allelic frequencies?
A = 100 + 150 = 250/420 = 0.595238 = 59.5238%
420
a = 20 + 150 = 170/420 = 0.4047619 = 40.47619%
420
C) What are the expected genotype frequencies?
AA = p2 = (0.595238)2 = 0.354308
Aa = 2pq = [2(0.595238)(0.4047619)] = 0.4818593
aa = q2 = (0.4047619)2 = 0.1638321
D) Is the population in Hardy-Weinberg equilibrium? Use the Chi Square test.
Observed Expected
AA 50 0.354308 x 210 = 74.40468
Aa 150 0.4818593 x 210 = 101.19045
aa 10 0.1638321 x 210 = 34.404741
X2 = 8.004717 + 23.54345 + 17.31132
= 48.85948
Therefore, the original population was not in HWE.
Extra Question (3 points)
Write the COMPLETE title of Darwin’s famous book and give its year of publication.
On the origin of species by means of natural selection or the preservation of favoured races in the struggle for life
1859
