Top Posters
Since Sunday
1
1
g
1
SlideshowReport

Producing human insulin in E. coli

Description
This strategy was used in the late 1970s by the City of Hope National Medical Center and the biotechnology company Genentech to produce human insulin in E. coli. The entire DNA fragment was chemically synthesizedThis strategy was used in the late 1970s by the City of Hope National Medical Center and the biotechnology company Genentech to produce human insulin in E. coli. The entire DNA fragment was chemically synthesized

0 Amino acid sequence of human insulin 8 diain was determined by peptide sequencing. l-l:Ynl'nrlimidmI-mtm'nmfflMlmOlMlmI'mNdm'.‘“I”Vhmlml'fit'm7'1m7-1mlim'dMl-lml-‘mhmhlmhm‘lmhem 1 2 3 4 5 6 7 8 91011121314151617181920212223 24252627282930 l e A nucleotide sequence was treated by reverse translation ofthe amino acid sequence. Two succesive stop codons were added following the open reading frame. Coding 5’ AA A A A AA A A A A AA A ' Template 3’ AAQQAQTTAQTQfiTQfiAAAQAQQAA§A§T§§A§§AAgTTgfiAAAQATfifiAAQAAAQfiQQ AQTTQQAQQ AAA§AA§AT§T§A§§ATT§T§mm5' l a A methionine codon was inserted atthe beginning ofthe insulin B coding sequence to facilitate subsequent isolation of the insulin 8 protein. 5' mrwmmmwmmmmmmmfimmmmmw 3' IMAGCAGTTAGTCGTG6AAACACCAAGAG TGGAGCAACTTCGAAACATGGAACAAACS CCACTTGCACCAAAGAAGATGTGAGGATT CTGMMS‘ l ow EcoRI and BamHI siteswere added to the ends ofthe DNA to facilitate doning into a vector. 9 The insulin 3 chain (blue) was cloned into cloning vector (right) as continuation of the lad reading frame (orange). _creating a fusion protein; expression ofthe fusion gene is induced by lactose. E. coli expression vector: Transcription is controlled by EcoRl the lac operon operator (0) and promoter (P) sequences. a The protein produced in E. coliwas purified and I the human insulin 3 chain was separated from In vitro cyanogen fi-gal by in vitro cyanogen bromide cleavage. bromide cleavage o The insulin A chain was produced using 1 a similar strategy. Active insulin was M +m produced after mixing the two purified chains together in an oxidizing atmosphere Insulin 3 chain to induce disulfide bonds between the cysteine residue of the two drains.
Related Images
Add Comment
Explore
Post your homework questions and get free online help from our incredible volunteers
  1144 People Browsing