× Didn't find what you were looking for? Ask a question
Top Posters
Since Sunday
5
a
5
k
5
c
5
B
5
l
5
C
4
s
4
a
4
t
4
i
4
r
4
Are you an expert?
Quickly gain a reputation by helping other students with their questions. When students see your nickname, they'll immediately associate your answer with credibility and expertise. Also, earn credits for sharing your knowledge and redeem them for rewards.
I am good at  
The GTP binding domain of elongation factor Tu (EF-Tu) and elongation factor 1α
The GTP binding domain of elongation factor Tu (EF-Tu) and elongation factor 1α
The GTP binding domain of elongation factor Tu (EF-Tu) and elongation factor 1α (EF-1 α) contains an eight amino acids conserved region, with the sequence FIKNMITG (using the one letter code).  Here you are designing only one of the two primers required for PCR.


a.   If you were using this region to design a primer to amplify by PCR the sense strand of EF-Tu/EF-1
Genetics and Developmental Biology   mki   394   Asked 9 years ago
Distance between shine delgarno and start codon affecting mRNA requirement?
Distance between shine delgarno and start codon affecting mRNA requirement?
Here's a question that I can't seem to grasp.

There are two mRNAs presented in the 5' to 3' direction, one of which belongs to strain A and the other one belonging to strain B.

Strain A's shine delgarno is further away from the AUG start codon (~17nucleotides)
Strain B's shine delgarno is optimal distance from the AUG start co
Genetics and Developmental Biology   Chadori   396   Asked 9 years ago
Paraphyletic groups
Paraphyletic groups
Which of these are paraphyletic groups?

Reptiles
Trees
Apes
Birds
Plants
Whales
Fish
Seaweed
Dinosaurs
Prokaryotes
Eukaryotes
Invertebrates
Humans
Chimps
Warm-blooded Animals

Genetics and Developmental Biology   beardy   408   Asked 10 years ago
DNA Synthesis: heated and cooled, fregments & total DNA. hybridized? Help!
DNA Synthesis: heated and cooled, fregments & total DNA. hybridized? Help!
1-   During DNA synthesis, small fragments of DNA are formed.  They were collected and combined with total DNA.  The mixture was heated and cooled down.  What would you expect to happen?
a.   The small fragments would hybridize together
b.   The small fragments would not hybridize to native DNA
c.   The small fragments would hybridize to the leading strand; the
Genetics and Developmental Biology   TinkerBell2175   410   Asked 9 years ago
How to solve lac operon problem? HW due tomorrow midnight!! ><
How to solve lac operon problem? HW due tomorrow midnight!! ><
Hello!

I was wondering if someone can explain how to solve a lac operon problem? The attached picture is the one from our problem sets and the answers are right, I just don't understand how to get the answers.  Frowning Face
Genetics and Developmental Biology   darwincalledit   417   Asked 9 years ago
Genetic Linkage and Map DIstance?
Genetic Linkage and Map DIstance?
Can you help me answering these questions?
Genetics and Developmental Biology   joebob   419   Asked 10 years ago
A cross was made to produce D. melanogaster flies heterozygous for two pairs of
A cross was made to produce D. melanogaster flies heterozygous for two pairs of
A cross was made to produce D. melanogaster flies
heterozygous for two pairs of alleles: A and a, which
determine long versus short wings, and B and b, which
determine gray versus ebony body color. The following F2
data were obtained:
Long wing, gray body 240
Long wing, ebony body 40
Short wing, gray body 40
Short wing, ebony body 80
Test
Genetics and Developmental Biology   bishoy93   421   Asked 9 years ago
Given the pedigree below, what is the probability...?
Given the pedigree below, what is the probability...?
The pedigree illustrated below (see attached jpeg file) shows a rare autosomal recessive trait. What is the probability that a child of III-4 and III-5 will manifest the phenotype for this trait?
Genetics and Developmental Biology   phyllidiela   424   Asked 9 years ago
Sex Linked Traits, Punnett squares, pedigrees?
Sex Linked Traits, Punnett squares, pedigrees?
In cats, an x-linked pair of alleles, B and B', determines the color of fur. The allele "B" for yellow is codominant with B' for black so that BB' cats are tortoise shelled, a splotchy mixture of yellow and black hairs. You and a friend are strolling down the street and see a tortoise shell cat. You bet your
Genetics and Developmental Biology   vafyfe   424   Asked 10 years ago
Gene map and arrangement with linkage
Gene map and arrangement with linkage
Please help me answer this question.
AaBbCc x aabbcc test cross with ABC linked and dominant. 2000 phenotypes observed with the following individuals counted out of 2000. establish the gene arrangement and map distances.
Genetics and Developmental Biology   ehd123   424   Asked 8 years ago
Creation of CFTR Knockout Mice by Injection of KO ES Cells into a Blastocyst
Creation of CFTR Knockout Mice by Injection of KO ES Cells into a Blastocyst
I'm really having a tough time with this KO mouse concept. If anyone could explain what is going on in each step, this would really help me.
Genetics and Developmental Biology   willuhelp   426   Asked 10 years ago
Where does the cut take place in palindrome sequence
Where does the cut take place in palindrome sequence
In the case of restriction enzymes, I know that it chooses Palindromes, but where does the exact cut take place? Is it always between A and T base pairs or Can it occur between any base pairs in a palindrome sequence.
Genetics and Developmental Biology   Bhargava   430   Asked 8 years ago
Please put the full answer Not just A,B
Please put the full answer Not just A,B
someone put only the answers but would you put it the full answer please instead only putting A,B Thanks.
Case Studies: Pediatrics: Congenital Heart Disease: Billy Adams

01) B

02) A

03) C

04) B

05) D

06) A

07) D

08) B

09) C

10) C

11) C

12) B
Genetics and Developmental Biology   jakson LL   432   Asked 9 years ago
Interpreting Cladograms
Interpreting Cladograms
Indicate whether each of these is plesiomorphic (ancestral) or apomorphic (derived) in the great ape lineage, using the phylogeny below. Great apes include orangutan, gorilla, chimp, and human.

Genetics and Developmental Biology   beardy   440   Asked 10 years ago
The likelihood of having identical children (who are not twins)
The likelihood of having identical children (who are not twins)
So I figure if you have enough babies (probably in the billions) you'd eventually get one that was essentially  genetically and/or aesthetically identical to another. Could anyone give me any background information and numbers regarding the likelihood of this?
Genetics and Developmental Biology   DarwinGoodell   443   Asked 8 years ago
How many possible alleles are at a locus consisting of 3 base-pairs in a diploid
How many possible alleles are at a locus consisting of 3 base-pairs in a diploid
ugh, I am so confused...

So, I guess a locus is just a spot for a gene, so the gene is also considered to consist of 3 bases?
Gene: _ _ _
Each "_" could be either an A,T,C, or G.
So there are 4 possibilities per "_"
So, there are 4 x 4 x 4 = 64 different possible alleles of a gene on one chromosome...?
Since there are 2 c
Genetics and Developmental Biology   Lo.Lee.Ta.   448   Asked 8 years ago
Epistatic pathway construction
Epistatic pathway construction
Based on the epistatic interactions shown below, construct a genetic pathway for the regulation of geoduck siphon length.

gene   mutant phenotype   
sipple   long siphon
geyuk   long siphon
hnuk           long siphon
stub            short siphon
nubin     short siphon

genotype   phenotype
sipple; stub   l
Genetics and Developmental Biology   xg3r4dx   449   Asked 9 years ago
Find the size of amplicon if we use the following PCR-primers for human GLUT1
Find the size of amplicon if we use the following PCR-primers for human GLUT1
Hello,

I have an exericise to solve at home:


What is the size of GLUT1 amplicon if we use the following PCR-primers for human
GLUT1? Please remember that we used human GLUT1 cDNA as a template.

GLUT1 sense: 5´AACTCTTCAGCCAGGGTCCAC 3´

GLUT1 antisense: 5´CACAGTGAAGATGATGAAGAC 3´


I tried to solve it myself but I d
Genetics and Developmental Biology   mashu   454   Asked 8 years ago
Neither individual I-4 or I-6 has ever had his or her blood tested. What are their blood types? ...
Neither individual I-4 or I-6 has ever had his or her blood tested. What are their blood types? ...
Neither individual I-4 or I-6 has ever had his or her blood tested. What are their blood types? Enter your answer in its simplest form.
 
I - 4 is blood type Answer
.
I - 6 is blood type Answer

PLEASE HELP!!!! Confounded Face
Genetics and Developmental Biology   txg   456   Asked 6 years ago
How to calculate genetic map units?
How to calculate genetic map units?
Can someone please tell me what is the formulae for calculating genetic map units?

Here is the question from my quiz:

The cross GE/ge × ge/ge produces the following progeny: GE/ge 404, ge/ge 396, gE/ge 97, Ge/ge 103. From these data, one can conclude that there are 20 map units between the G and E loci.

I know that the answer is TRUE, but how??
Genetics and Developmental Biology   lanister12   459   Asked 7 years ago
Genetics Crossing Dominant and true breeding
Genetics Crossing Dominant and true breeding
1. The ability to curl one’s tongue into a U-shape (Q) is dominant to noncurlers (q). A curler woman has a father who is a noncurler. She has five children with a noncurler man. What is the probability that four children are curlers and the other is a noncurler?

2. Your lab is investigating the genetics of a new species of beetle. You have isolated a truebreeding line tha
Genetics and Developmental Biology   MikeMello   461   Asked 9 years ago
gene mapping and recombination trait
gene mapping and recombination trait
In green turtles, an odd number of plates on there shell is dominant over an even number of plates. On the same chromosome is a gene for ear spot color with red being dominant over orange. On this same chromosome is the gene for strip color on the body with yellow being incompletely dominant with blue strips. These turtles were crossed in a breeding experiments and the following dat
Genetics and Developmental Biology   samya   462   Asked 9 years ago
The role of tumor suppressor genes in cancer developmen
The role of tumor suppressor genes in cancer developmen
 Confounded Face
Genetics and Developmental Biology   watermelona3   465   Asked 7 years ago
Use the following table of progeny phenotypes for 7 different deletions
Use the following table of progeny phenotypes for 7 different deletions
Deletions can be used to map genes along a chromosome. In order to do this a series of crosses in which one parent is homozygous for a mutant allele is crossed with the other parent that is homozygous for a partial deletion of the region. The progeny are scored to determine whether they have the mutant phenotype ("m") or the wild-type phenotype ("+"). If a mutati
Genetics and Developmental Biology   sk2340   465   Asked 8 years ago
Fusion of two mutant haploid cells to produce a cell that grows on minimal media
Fusion of two mutant haploid cells to produce a cell that grows on minimal media
I have attached the question(#25).Can someone please explain this conceptually.I know it has to do with complementation.
Genetics and Developmental Biology   s2kmanny   472   Asked 10 years ago
how many genes are in the F2?
how many genes are in the F2?
how many genes contribute to tooth length
variation in saber tooth tigers?

 what phenotypic classes would you expect to
observe in the F2 generation?
Genetics and Developmental Biology   xg3r4dx   472   Asked 9 years ago
need help with confusing genetics problem
need help with confusing genetics problem
I can't figure out how to do the punnet square for any of this or what it all means? Can anyone please explain how to understand the solution? Looks like a bunch of letters and numbers to me.

Red-green color-blindness is an X-linked recessive trait in humans. Polydactyly (extra fingers and toes) is an autosomal dominant trait. Martha has normal fingers and toe
Genetics and Developmental Biology   centimetergrove   473   Asked 10 years ago
Tyrosine kinase and blood pressure regulation
Tyrosine kinase and blood pressure regulation
I am having trouble answering this question for my physiology homework:

Using cell culture models, how would one determine the role of tyrosine kinases on blood pressure regulation?

And what are some of the possible limits to this study?


Thanks!
Genetics and Developmental Biology   jessicawcu   475   Asked 8 years ago
An AABbccDdEeFF individual is crossed with an individual with the genotype AaBBC
An AABbccDdEeFF individual is crossed with an individual with the genotype AaBBC
Question: An AABbccDdEeFF individual is crossed with an individual with the genotype AaBBCCDdEeff. What is the probability that their offspring will have the genotype AaBBCcddEEFf?

Can someone help and explain how to figure this out?
thanks,
Genetics and Developmental Biology   nsch22   480   Asked 10 years ago
Analyzing chromosome 1 of a male and female
Analyzing chromosome 1 of a male and female
1. The first child of this couple was Rh- (Rhesus negative). What is the chance that the second child of this is a girl and Rh- (Rhesus negative)? Use Punnett squares and/or the calculation to show your work.

2. Nomenclature for writing alleles on a homologous chromosome pair
 
The phrase DEP/dep means the first three letters, DEP, represent the order in
Genetics and Developmental Biology   helpmepassbio   480   Asked 6 years ago
Transmission Ratio Distortion
Transmission Ratio Distortion
Transmission Ratio Distortion is the inheritance of genes in a non-mendelian ratio.
Also known as meiotic drive..

Can anyone give me some of the general characteristics of a TRD system?
Thank you in advance!
Genetics and Developmental Biology   crmilano   485   Asked 11 years ago
Quantitative Inheritance Questions
Quantitative Inheritance Questions
. In rye grass, seed color is a polygenic trait (additive model). If true-breeding red and white varieties are crossed, the F1 are intermediate in color. If the F1 are self-fertilized, about 1 in 64 have white seeds. If the F1 are testcrossed, how many different genotypic categories will be produced?

A. one
B. two
C. three
D. eight
E. 64
7. In rye
Genetics and Developmental Biology   D-rose   491   Asked 9 years ago
Dual Luciferase Reporter Gene Assays
Dual Luciferase Reporter Gene Assays
The accuracy of reporter assays can be improved by utilizing a dual reporter system. One of the reporter genes is correlated with the promoter of interest and is used to assess the effects of specific experimental conditions, while the second reporter is used as a control and serves as a baseline response. The Super Light™ Dual- Luciferase Reporter Assay allows for the sequential me
Genetics and Developmental Biology   MarkHolland   493   Asked 11 years ago
Help with Identificatying Restriction Enzyme Recognition Sites in a DNA sequence
Help with Identificatying Restriction Enzyme Recognition Sites in a DNA sequence
Hi Folks,

I'm really struggling with a PCR & restriction enzyme question that's part of my formative (unmarked) work for the summer months in preparation from an Applied Biology course at University.

The entire set of questions are set out on an instruction sheet so I'll try to replicate them here as I'm struggling to fully understand ho
Genetics and Developmental Biology   AppliedBiology9   497   Asked 7 years ago
Interpretation of Tajimas and Wattersons θ theta
Interpretation of Tajimas and Wattersons θ theta
I need help in interpretation of  Tajimas and Wattersons θ theta values calculated for DNA sequences. Avarage values =

Theta Wattersons:

0,003516526
0,003308895
0,003252474
0,002339263

Tajimas:

0,003373737
0,003073789
0,003314842
0,002048579

What you can tell about them?
Genetics and Developmental Biology   gacek758   517   Asked 10 years ago
Chromosome Problems
Chromosome Problems
Consider a diploid cell where 2n = 6. During metaphase I of meiosis, as the pairs of homologous chromosomes line up on the metaphase plate, each pair may orient with its maternal or paternal homolog closer to a given pole. There are four equally probable arrangements of the homologous pairs at metaphase I. (Note that this problem assumes that no crossing over has occurred.)
Genetics and Developmental Biology   BriannaG1996   534   Asked 9 years ago
Identify the most likely mode of inheritance found in this pedigree
Identify the most likely mode of inheritance found in this pedigree
I think that the most likely mode would be autosomal dominance with incomplete penetrance because it did skip one generation. Any help would be greatly appreciated. Let me know what you think it is and please also write why you think it is that. Thanks!
Genetics and Developmental Biology   hooglandm   536   Asked 8 years ago
What would be the size in base pairs of the largest and smallest amplicons that would be expected if
What would be the size in base pairs of the largest and smallest amplicons that would be expected if
Relevant details of the STRs are as follows

TH01

Chromosomal location: 11p15.5 (tyrosine hydroxylase, 1st intron)
Repeat motif: TCAT (GenBank top strand) although AATG (bottom strand) often used. Note that variants with a [AATG]nATG[AATG]n structure quite common e.g. [AATG]6ATG[AATG]3 would be 9.3 repeats.
Allele range: 3-14



For
Genetics and Developmental Biology   05mbodh   539   Asked 7 years ago
how to analyse PCR
how to analyse PCR
The question asks  to calculate the tandem repeats in the D1S80 allele. i plotted the graph but im not sure what to do from there.
next question asks to be figure outhow many diffferent classes of homozygous and heterozygous exist?
any help will be greatly appreciated
Post Merge: 11 years ago

anyone?
Genetics and Developmental Biology   julle12345678   545   Asked 11 years ago
Design a yeast strain that would turn blue when fed...... Please help!
Design a yeast strain that would turn blue when fed...... Please help!
1.   Design a yeast strain that would turn blue when fed medium that contains hydrolyzed rice and beans (hydrolysis breaks proteins down to their constituent amino acids) plus threoninol and X-gal.  Draw the structure of the gene/mRNA that will give the yeast this phenotype and describe the molecular events that lead to the yeast turning blue on medium containing hydrolyzed rice
Genetics and Developmental Biology   fecster   554   Asked 10 years ago
Explore
Post your homework questions and get free online help from our incredible volunteers
  1253 People Browsing
Gallery
  
 126
  
 271
  
 284
Your Opinion
What percentage of nature vs. nurture dictates human intelligence?
Votes: 431