Genetics and Developmental Biology

1 question different parts

1 question different parts

Use the following information to answer the next four questions.

Tomato Plant Leaves
In tomatoes, regular leaves (L) are multilobed and serrated and potato leaves (l) are broad, smooth, and single (Image 1). Red fruit (F) is dominant

Anonymous   545   11 Replies

Yvane KKL

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

I'm attempting to replicate a yeast transformation from a paper. The paper denotes that the strain which generated the best results as follows:

Name: ST9482
Parental Strain: ST9318
Added DNA Element: pC

germinate_love   346   5 Replies

dietervdwes

Is this what the transcribed mRNA would look like?

Is this what the transcribed mRNA would look like?

So there's a DNA sequence with a double stranded
DNA with a open reading frame encoding a small
polypeptide 5'
ATGGAGGAACCGCAGTCAGATCCTAGCTA GGTC3'
3' TACCTCCTTGGCGTCAGTCTAGGATCGAT CCAG 5'
So the mRNA t

Question Bio   56   1 Reply

bio_man

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles have the genotype A2A2, while lighter beetles have an A1A1 genotype; heterozygotes have a phenotype that is closer to that of the A1A1 homozygotes. Th

pkclary   2182   4 Replies

mastema

Gene Interaction - Mastering Chemistry, Alleles?

Gene Interaction - Mastering Chemistry, Alleles?

Based on your analysis so far, you assign the following allele symbols to the three lines:
Wild type = A_ V_
Aberdeen White = a a
Kansas Yellow = aYaY
Victoria White = v v

Using these symbols, assign genotypes to the

12...78

loljaneysaur   15796   99 Replies

Noor Amin

Part B - How can someone with a Y chromosome develop as a female?

Part B - How can someone with a Y chromosome develop as a female?

One key determinant of sex determination is the SRY gene itself. This gene is located on the Y chromosome, and the protein it encodes is a DNA binding protein that regulates other genes. The normal action of the SRY protein is to induce transcr

123

dimplepatel2013   10974   30 Replies

urine tsunami

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci assort independently, determine the following proportions:


gametes that are expected to carry only dominant alleles.
Express your answer using thr

12

sjohn092   10120   26 Replies

Hausr

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

For the molecular defects listed below, predict what their effects would be on AR signaling and ultimately on the development of the genital

1234

dimplepatel2013   14435   46 Replies

wigga

DNA Essay Comp

DNA Essay Comp

Hello!

I'm currently working on writing an essay from a competition with the following prompt:

"Many human diseases have a genetic component. Some diseases result from a change in a single gene or even multiple genes

Anonymous   138   5 Replies

bio_man

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an unstrained circle?  (L = linking number, T = twist and W = writhe)

A) L = 12, T = 12, W = 0
B) L = 11, T = 11, W = 0
C) L = 11, T =

bogdan   190   2 Replies

Anonymous

No one else posted this, so I thought I would: Punnett Squares

No one else posted this, so I thought I would: Punnett Squares

When Gregor Mendel conducted his genetic experiments with pea plants, he observed that a trait’s inheritance pattern was the same regardless of whether the trait was inherited from the maternal or paternal parent. Mendel made these observations by ca

theturkey   19174   7 Replies

Thandi Miti

how do i do this question

how do i do this question

Which of the following are potential restriction enzyme sites (circle candidates)(2 marks)?
a. 5’-aggcct b. 5’-ttataa c. 5’-gaccag d. 5’-ttaatt

which are the answer

toodaloo   360   1 Reply

bolbol

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

As you have determined, the F1 is heterozygous for four loci that affect fruit segment number (A+ A 0 B+ B 0 C+ C 0 D+ D 0). This means that the F1 can produce 16 distinct gamete typ

1234

paramed91   7527   55 Replies

Tito Tito

Determining parental and F1 genotypes in crosses involving polygenic inheritance

Determining parental and F1 genotypes in crosses involving polygenic inheritance

You decide to designate the alleles of the four loci as either additive (contributing to fruit segment number and represented by a superscript “+”) or non-additive (not contributing to fruit segment number and represented by a superscript “0”). Using

12

KendraJo   9341   26 Replies

Daryam Galan

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations.  In order for children to have this trait, at least one parent must have woolly hair.  How is this trait most likely inherited? Draw a pedigree for a family

smand   2128   8 Replies

1muhammadmus

Three of the most prominent definitions of species are the biological species concept, the phylogene

Three of the most prominent definitions of species are the biological species concept, the phylogene

Part A - Comparing species definitions
Three of the most prominent definitions of species are the biological species concept, the phylogenetic species concept, and the morphological species (morphospecies) concept.
Drag each characteristic

123

hunter4565   74805   31 Replies

bioresearch

Dna sequence help

Dna sequence help

I’ve got these two images, not sure what they show. I’ve got an exam on them but we haven’t got the questions yet. Can anyone help with what it shows or any ideas on what the question could be?

Any help would be appreciated
Thank yo

Anonymous   8   N/A

Anonymous