Genetics and Developmental Biology

Dna sequence help

Dna sequence help

I’ve got these two images, not sure what they show. I’ve got an exam on them but we haven’t got the questions yet. Can anyone help with what it shows or any ideas on what the question could be?

Any help would be appreciated
Thank yo

Anonymous   6   N/A

Anonymous

Three of the most prominent definitions of species are the biological species concept, the phylogene

Three of the most prominent definitions of species are the biological species concept, the phylogene

Part A - Comparing species definitions
Three of the most prominent definitions of species are the biological species concept, the phylogenetic species concept, and the morphological species (morphospecies) concept.
Drag each characteristic

123

hunter4565   74804   31 Replies

bioresearch

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations. In order for chi

In certain families in Norway, woolly hair is passed down through the generations.  In order for children to have this trait, at least one parent must have woolly hair.  How is this trait most likely inherited? Draw a pedigree for a family

smand   2128   8 Replies

1muhammadmus

Determining parental and F1 genotypes in crosses involving polygenic inheritance

Determining parental and F1 genotypes in crosses involving polygenic inheritance

You decide to designate the alleles of the four loci as either additive (contributing to fruit segment number and represented by a superscript “+”) or non-additive (not contributing to fruit segment number and represented by a superscript “0”). Using

12

KendraJo   9340   26 Replies

Daryam Galan

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

Part C - Gamete formation in the F1 of polygenic crosses

As you have determined, the F1 is heterozygous for four loci that affect fruit segment number (A+ A 0 B+ B 0 C+ C 0 D+ D 0). This means that the F1 can produce 16 distinct gamete typ

1234

paramed91   7525   55 Replies

Tito Tito

how do i do this question

how do i do this question

Which of the following are potential restriction enzyme sites (circle candidates)(2 marks)?
a. 5’-aggcct b. 5’-ttataa c. 5’-gaccag d. 5’-ttaatt

which are the answer

toodaloo   360   1 Reply

bolbol

No one else posted this, so I thought I would: Punnett Squares

No one else posted this, so I thought I would: Punnett Squares

When Gregor Mendel conducted his genetic experiments with pea plants, he observed that a trait’s inheritance pattern was the same regardless of whether the trait was inherited from the maternal or paternal parent. Mendel made these observations by ca

theturkey   19174   7 Replies

Thandi Miti

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an ...

In a circular DNA molecule of 126 bp with 10.5 bp/turn, which of the following represents an unstrained circle?  (L = linking number, T = twist and W = writhe)

A) L = 12, T = 12, W = 0
B) L = 11, T = 11, W = 0
C) L = 11, T =

bogdan   190   2 Replies

Anonymous

DNA Essay Comp

DNA Essay Comp

Hello!

I'm currently working on writing an essay from a competition with the following prompt:

"Many human diseases have a genetic component. Some diseases result from a change in a single gene or even multiple genes

Anonymous   138   5 Replies

bio_man

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

You recognize that Athlete 2 may have one of several possible defects in the AR signaling pathway.

For the molecular defects listed below, predict what their effects would be on AR signaling and ultimately on the development of the genital

1234

dimplepatel2013   14435   46 Replies

wigga

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci

An organism having the genotype AaBbCcDdEe is self-fertilized. Assuming the loci assort independently, determine the following proportions:


gametes that are expected to carry only dominant alleles.
Express your answer using thr

12

sjohn092   10120   26 Replies

Hausr

Part B - How can someone with a Y chromosome develop as a female?

Part B - How can someone with a Y chromosome develop as a female?

One key determinant of sex determination is the SRY gene itself. This gene is located on the Y chromosome, and the protein it encodes is a DNA binding protein that regulates other genes. The normal action of the SRY protein is to induce transcr

123

dimplepatel2013   10974   30 Replies

urine tsunami

Gene Interaction - Mastering Chemistry, Alleles?

Gene Interaction - Mastering Chemistry, Alleles?

Based on your analysis so far, you assign the following allele symbols to the three lines:
Wild type = A_ V_
Aberdeen White = a a
Kansas Yellow = aYaY
Victoria White = v v

Using these symbols, assign genotypes to the

12...78

loljaneysaur   15795   99 Replies

Noor Amin

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles ...

A population of beetles lives on a forest floor, which is covered in dark leaf litter. Dark beetles have the genotype A2A2, while lighter beetles have an A1A1 genotype; heterozygotes have a phenotype that is closer to that of the A1A1 homozygotes. Th

pkclary   2182   4 Replies

mastema

Is this what the transcribed mRNA would look like?

Is this what the transcribed mRNA would look like?

So there's a DNA sequence with a double stranded
DNA with a open reading frame encoding a small
polypeptide 5'
ATGGAGGAACCGCAGTCAGATCCTAGCTA GGTC3'
3' TACCTCCTTGGCGTCAGTCTAGGATCGAT CCAG 5'
So the mRNA t

Question Bio   55   1 Reply

bio_man

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

Replicating DNA Cassette from Parent Strain, Plasmid Vector and Genotype

I'm attempting to replicate a yeast transformation from a paper. The paper denotes that the strain which generated the best results as follows:

Name: ST9482
Parental Strain: ST9318
Added DNA Element: pC

germinate_love   346   5 Replies

dietervdwes

1 question different parts

1 question different parts

Use the following information to answer the next four questions.

Tomato Plant Leaves
In tomatoes, regular leaves (L) are multilobed and serrated and potato leaves (l) are broad, smooth, and single (Image 1). Red fruit (F) is dominant

Anonymous   545   11 Replies

Yvane KKL

What are Homologous Chromosomes? Are They Present in All Cells?

What are Homologous Chromosomes? Are They Present in All Cells?

I need help precisely answering the attachment below

Identify Homologous Chromosomes and Sister Chromatids in appropriate phases.
What are homologous chromosomes? Are they present in all cells? If not, which
cells lack homologo

Fedoraman   101   4 Replies

bio_man

2 questions answer all parts please

2 questions answer all parts please

1) Match the following formulas with their correct descriptions form the drop down menu provided.

Formulas

1. Dp equals N over A
2 Dp equals N over V
3. increment N equals open parentheses N plus I close parentheses mi

Anonymous   313   6 Replies

inaayaz

11 questions i Need support ASAP

11 questions i Need support ASAP

1) Which of the following statements correctly describes a Y-linked trait?

a.  It can be inherited by a daughter from her father.

b. It will always be expressed if present in male individuals. 

c.  It

Anonymous   495   6 Replies

kumbu gozo

Who is the father of Snowball

Who is the father of Snowball

Here is a question from my bio homework:

At a local buffalo farm an albino calf named Snowball is born. Snowball is the first albino buffalo born to this herd. The allele for albinism is recessive to the allele for normal coloration. Snowb

12

jessicawcu   6774   15 Replies

THAVY VANTHON

Mapping with trihybrid (three-point) test crosses! Help?

Mapping with trihybrid (three-point) test crosses! Help?

You examine 450 progeny from the cross in Part C and classify them according to phenotype. The results are shown in the table below.

!See Below Image!

Use these data to complete the linkage map shown below.
Drag the blue la

12

hunter4565   23347   14 Replies

carlgru

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crim

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crim

You have also identified a third recessive mutation that you call crimson. Wasps homozygous for crimson have a red abdomen. (Wild-type abdomens are yellow.)

You make pure-breeding crimson (cc) and triple-mutant (apricot, blunt, crimson) li

123

sammiebb   18164   34 Replies

farida Abdelgawad

I need help with this questions is one long and 4short

I need help with this questions is one long and 4short

1) In guinea pigs, a black coat (B) is dominant over a white coat (b), and straight hair (S) is dominant over curly hair (s). A heterozygous, black, and straight hair guinea pig (BbSs) was test crossed.


A) Which of the following rows

Anonymous   228   2 Replies

U No

How to draw a 2N=6 cell in both mitosis and meiosis

How to draw a 2N=6 cell in both mitosis and meiosis

I am having trouble trying to figure out how to draw a cell in mitosis and in meiosis.

For example, how do you draw a 2N=6 cell with chromosomes in mitosis during prophase, metaphase, anaphase, and telophase

How would you draw

sjohn092   8127   7 Replies

sissus123

A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three ...

A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three ...

Q; A farmer crosses a black rooster with a white hen. Of the seven offspring, three are black, three are speckled black and white, and one is white.
a) What can you infer about the inheritance patterns of the alleles for white and black feathers

Jess8219   3826   12 Replies

andresgs04

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for

CD 40 on the B cell membrane must bind to CD40L on the TH cell in order for  (BLANK) to occur                                           &nbs

alwhite   460   1 Reply

bolbol

3 questions some are attached please answer all I NEED IT NOW THANKS

3 questions some are attached please answer all I NEED IT NOW THANKS

1) See first image 
Identify the phase(s) from the image above that best illustrates each of the following stages of mitosis AND include your explanation of why. (2 marks).

a. Interphase
b. Prophase
c. Metaphase

Anonymous   287   4 Replies

Noa Mastin

DNA changes with age. Predictable?

DNA changes with age. Predictable?

Are all DNA damages and mutations random, or do they follow a predictable pattern with age?

CarbonRobot   160   3 Replies

bio_man

Dideoxynucleotide DNA sequencing (Mastering Genetics)

Dideoxynucleotide DNA sequencing (Mastering Genetics)

The diagram below shows an autoradiograph of a DNA sequencing gel.

Type the 5' to 3' sequence of the template strand (“inferred strand”) based on the pattern in this gel. Use only capital letters for the sequence.

mmurt13   11164   7 Replies

Poliann Flores

Calculating probabilities in pedigrees

Calculating probabilities in pedigrees

Individuals III-3 and III-4 are expecting their first child when they become aware that they both have a family history of this recessive condition. As their genetic counselor, you can calculate the probability that they are carriers and that their c

12

jessiijessii   60500   19 Replies

Emilia Diaz

Support need it please 10 questions SEE IMAGES

Support need it please 10 questions SEE IMAGES

1) Which row correctly identifies the function and source of hCG, respectively?

a.Function                                Source
Stimulates FSH  &nb

Anonymous   207   4 Replies

Anonymous

) Mexican hairless dogs are heterozygous (Hh), carrying a single copy of the dom

) Mexican hairless dogs are heterozygous (Hh), carrying a single copy of the dom

) Mexican hairless dogs are heterozygous (Hh), carrying a single copy of the dominant lethal allele. In a given population, the Hh genotypic frequency is 60% and the frequency of each homozygote is 20%. Assuming w = 1 for the Hh and hh dogs, what is

mikael   1431   10 Replies

padre

Identify which pattern(s) of transmission is/are impossible.

Identify which pattern(s) of transmission is/are impossible.

Identify which pattern(s) of transmission is/are impossible. Specify why transmission is impossible. (AD = autosomal dominant, AR = autosomal recessive, XR = X-linked recessive, XD = X-linked dominant)

srmtrc   2146   6 Replies

LookshaC4

Race is to ethnicity as:

Race is to ethnicity as:

Race is to ethnicity as:

   A.   
individualism is to collectivism.
   B.   
biological is to cultural.
   C.   
nurture is to nature.
   D.   
theoretical research is to applied research.

angie21   448   1 Reply

bolbol

Write the genotype including chromosomes relevant to the cross

Write the genotype including chromosomes relevant to the cross

Example of Balancer chromosomes utilization in crosses

Example: create double mutant stock starting from the following 3 stocks:
mut A  / mut A    (II chromosome)
mut C / mut C    (III chromosome)
I

hac1   1026   6 Replies

Mo097utb

People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals w

People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals w

36.People with nail­patella syndrome have poorly developed or absent kneecaps and nails. Individuals with alkaptonuria have arthritis as well as urine that darkens when exposed to air. Both nail­patella syndrome and alkaptonuria are rare phenotypes.

12

sonya36   4274   26 Replies

School Email

How do bacteria regulate transcription of these operons? (Mastering Genetics)

How do bacteria regulate transcription of these operons? (Mastering Genetics)

The question is about regulation of model operons.
The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of these operons?
Sort the statements into the appropriate bins depending on whether or not eac

12

KC53   36953   15 Replies

Helen91

13 QUESTIONS I NEED IT TODAY ANSWER ALL IF YOU WANT PLEASE

13 QUESTIONS I NEED IT TODAY ANSWER ALL IF YOU WANT PLEASE

1) What is the first process in protein synthesis that is affected by a missense mutation?

a. None of the above

b. Translation

c. Replication

d. Transcription

Anonymous   245   4 Replies

Carolina Castillo2

4 QUESTIONS PLEASE ANSWER ALL I DONT HAVE MORE CREDITS AND I NEED IT TODAY

4 QUESTIONS PLEASE ANSWER ALL I DONT HAVE MORE CREDITS AND I NEED IT TODAY

1) The longest phase of the cell cycle is Answer  and the shortest is Answer.

POSSIBLE ANSWERS: INTERPHASE,PROPHASE, METAPHASE,ANAPHASE, TELOPHASE, CYTOKINESIS







2) SEE IMAGE ATTACED

Anonymous   163   2 Replies

Carolina Castillo2