General Biology

Identify the variables listed below.

Identify the variables listed below.

Identify the variables listed below.

  1.  Urine Samples
  2. Temperature of the water bath
  3.  Colour Change


 Number:    ____                ____       &nb

4bio   179   1 Reply

bio_man

Match the hormone secreted with the correct function in the human reproductive systems.

Match the hormone secreted with the correct function in the human reproductive systems.

LH (in males)

PRL

progesterone

FSH

oxytocin

testosterone

LH (in females)

GnRH

inhibin

estrogen

1. triggers ovulation, stimulates the corpus

4bio   200   1 Reply

bio_man

During ovulation, production of the hormones

During ovulation, production of the hormones

During ovulation, production of the hormones

a. estrogen and LH is high
b. FSH and estrogen stops
c. progesterone and FSH is high
d. estrogen and progesterone is low

4bio   110   1 Reply

bio_man

Damage to a female's pituitary gland immediately before puberty may result in

Damage to a female's pituitary gland immediately before puberty may result in

Damage to a female's pituitary gland immediately before puberty may result in

a. a reduction in estrogen production and inhibition of the development of secondary sexual characteristics
b. a reduction in estrogen production and s

4bio   156   1 Reply

bio_man

Males exposed to high levels of estrogen-mimicking chemicals might experience

Males exposed to high levels of estrogen-mimicking chemicals might experience

Hormones influence the growth and maintenance of human body systems. Endocrine disruptors from pollution can result in various abnormalities. Scientists are studying the link between pesticides, plastic products, perfumes, soaps, and effluent from pa

4bio   104   3 Replies

bio_man

Eye colour in humans appears to be controlled by multiple alleles.

Eye colour in humans appears to be controlled by multiple alleles.

 Eye colour in humans appears to be controlled by multiple alleles. The green allele and the brown allele are dominant to blue. Green eye colour is expressed only in the absence of a brown allele.

Red-green colour blindness is a sex-linked

4bio   216   3 Replies

bio_man

The row that indicates the genotypes of individuals I-1, I-2, and II-2 is

The row that indicates the genotypes of individuals I-1, I-2, and II-2 is

The row that indicates the genotypes of individuals I-1, I-2, and II-2 is

a. A
b. B
c. C
d. D

4bio   333   2 Replies

4bio

Based on this pedigree

Based on this pedigree

Based on this pedigree,

Select one:
a. it is impossible to determine whether individual II-5 is a carrier
b. the probability that individual II-5 is a carrier is 50%
c. if individual III-3 is a carrier, all of her female chi

4bio   131   2 Replies

4bio

The colour of eyes in fruit flies

The colour of eyes in fruit flies

The colour of eyes in fruit flies is determined by a gene on the X chromosome with two alleles.

    XR = red eyes;         Xr = white eyes

Cross a red eye male to a white eye female. Write the genot

4bio   134   3 Replies

4bio

Which row correctly identifies process 1 and 2 and indicates the locations in which these processes ...

Which row correctly identifies process 1 and 2 and indicates the locations in which these processes ...

Which row correctly identifies process 1 and 2 and indicates the locations in which these processes occur?

Row             Process 1                      

4bio   306   2 Replies

4bio

Messenger RNA (mRNA) is a single-stranded molecule that passes through nuclear pores into the ...

Messenger RNA (mRNA) is a single-stranded molecule that passes through nuclear pores into the ...

Messenger RNA (mRNA) is a single-stranded molecule that passes through nuclear pores into the cytoplasm to ribosomes situated on the endoplasmic reticulum. The triplet codons are read from mRNA as it passes through the ribosome. The function of tRNA

4bio   1851   5 Replies

bio_man

When the tRNA anticodons match for the mRNA triplet codons, then the amino acid sequence synthesized ...

When the tRNA anticodons match for the mRNA triplet codons, then the amino acid sequence synthesized ...

When the tRNA anticodons match for the mRNA triplet codons, then the amino acid sequence synthesized is_______,_______and________.
 
Is this sequence the same as the order of amino acids in hemoglobin illustrated in the beginning of this e

4bio   2517   6 Replies

bio_man

Suppose that in a fruit fly population the frequency of the recessive allele that codes for short ...

Suppose that in a fruit fly population the frequency of the recessive allele that codes for short ...

Suppose that in a fruit fly population the frequency of the recessive allele that codes for short wings (l) is 0.41. What would be the expected homozygous recessive genotype frequency in the next generation? The population is not evolving. Round your

4bio   237   2 Replies

4bio

In a pea plant population, the dominant allele for tallness (T) has a frequency of 0.13

In a pea plant population, the dominant allele for tallness (T) has a frequency of 0.13

In a pea plant population, the dominant allele for tallness (T) has a frequency of 0.13. What percent of the population would be expected to be heterozygous (Tt) for the height gene?

4bio   271   1 Reply

bolbol

In a randomly mating population of mice, 14 of every 100 mice born have white fur, a recessive trait

In a randomly mating population of mice, 14 of every 100 mice born have white fur, a recessive trait

In a randomly mating population of mice, 14 of every 100 mice born have white fur, a recessive trait. Calculate the frequency of the allele (G) in the population.

4bio   341   2 Replies

4bio

In a randomly mating population of mice, 17 out of every 100 mice born have white fur, a recessive ...

In a randomly mating population of mice, 17 out of every 100 mice born have white fur, a recessive ...

In a randomly mating population of mice, 17 out of every  100 mice born have white fur, a recessive trait. Calculate the homozygous recessive frequency for the population.

4bio   325   2 Replies

4bio

The four processes that change the number of individuals in population size relative to the original ...

The four processes that change the number of individuals in population size relative to the original ...

The four processes that change the number of individuals in population size relative to the original number are

Select one:
a. birth rate, immigration, migration, and biotic potential
b. natality, immigration, mortality, and emig

4bio   173   3 Replies

bio_man

Suppose that sample of beef broth initially contains 16 bacterial cells

Suppose that sample of beef broth initially contains 16 bacterial cells

Suppose that sample of beef broth initially contains 16 bacterial cells. After 4.0 h, there are 1.6 x 10^6 bacterial cells in the sample. Calculate the growth rate of the bacterial population for the given time interval.
1 mark

Record

4bio   1973   2 Replies

Martinespanioli

Lemna minor, a species of duckweed, can reproduce to form new plants very quickly.

Lemna minor, a species of duckweed, can reproduce to form new plants very quickly.

Lemna minor, a species of duckweed, can reproduce to form new plants very quickly. Suppose that a small backyard pond of 100 L contains 25 Lemna minor plants, and the expected growth rate of the population is 1.0 x 10^2 plants per day.

Num

4bio   1028   2 Replies

4bio

Intraspecific competition limits a population size as

Intraspecific competition limits a population size as

 Intraspecific competition limits a population size as

Select one:
a. competition for resources intensifies as two species compete for resources
b. certain alleles give some individuals a competitive advantage; "less fit&quo

4bio   562   3 Replies

moose225

In the Caucasian population of North America, one out every 10 000 babies is born with a recessive ...

In the Caucasian population of North America, one out every 10 000 babies is born with a recessive ...

In the Caucasian population of North America, one out every 10 000 babies is born with a recessive condition known as phenylketonuria (PKU). This condition is controlled by a single pair of alleles. People who are homozygous recessive for the PKU gen

4bio   467   1 Reply

bio_man

The M and N factors are glycoproteins on the surface of red blood cells.

The M and N factors are glycoproteins on the surface of red blood cells.

The M and N factors are glycoproteins on the surface of red blood cells. Unlike other types of red blood cell antigens, the M and N factors do not cause antibody reactions in human blood transfusions. People with type M blood are homozygous for the M

4bio   1082   1 Reply

bio_man

The M and N factors are glycoproteins on the surface of red blood cells.

The M and N factors are glycoproteins on the surface of red blood cells.

The M and N factors are glycoproteins on the surface of red blood cells. Unlike other types of red blood cell antigens, the M and N factors do not cause antibody reactions in human blood transfusions. People with type M blood are homozygous for the M

4bio   364   5 Replies

bio_man

Describe the shape of the age pyramid for each country

Describe the shape of the age pyramid for each country

Examine the age pyramids shown below.

A) Describe the shape of the age pyramid for each country.

B) For each country, which would be greater—the birth rate or the death rate? Explain your answer.

C) Explain how the ag

4bio   302   2 Replies

4bio

Which is a difference between eyes and the photosynthetic apparatus of plants and algae?

Which is a difference between eyes and the photosynthetic apparatus of plants and algae?

[html]Which is a difference between eyes and the photosynthetic apparatus of plants and algae?

54152151   51   1 Reply

Zenoryx

What is the difference between a gene knockout and a gene knockdown?

What is the difference between a gene knockout and a gene knockdown?

What is the difference between a gene knockout and a gene knockdown?

54152151   44   1 Reply

Myiaaaaaahhhh

What happens to the body parts, according to the principle of use and disuse?

What happens to the body parts, according to the principle of use and disuse?

[html]What happens to the body parts, according to the principle of use and disuse?


▸

54152151   53   1 Reply

FlamingAura5

Which of the following is characteristic of adaptive traits?

Which of the following is characteristic of adaptive traits?

[html]Which of the following is characteristic of adaptive traits?


▸

54152151   73   1 Reply

eclarkie

The history of hominins clearly demonstrates challenges inherent in recognizing species and the ...

The history of hominins clearly demonstrates challenges inherent in recognizing species and the ...

[html]The history of hominins clearly demonstrates challenges inherent in recognizing species and the boundaries between them. Which of the following evidence is the example

54152151   42   1 Reply

mh.halimi

Does variation of preferred temperature change catalase denaturation?

Does variation of preferred temperature change catalase denaturation?

For example, spinach's preferred temperature for growth is around 12°C and eggplant is around 25°C. Does that have any effect on the catalase? Catalase's preferred temp is around 37°C in humans, because that's our body temperature, but

Anonymous   114   1 Reply

bio_man

The Alberta greater sage grouse population was about 4375 in 1970. By 2002, the population was ...

The Alberta greater sage grouse population was about 4375 in 1970. By 2002, the population was ...

1. The Alberta greater sage grouse population was about 4375 in 1970. By 2002, the population was estimated to be only about 350 birds. Calculate the population growth rate for the population from 1970 to2002.


2. Lemna minor, a speci

7dog47   3052   4 Replies

Ch In

Calculating the growth rate

Calculating the growth rate

Suppose that sample of beef broth initially contains 16 bacterial cells. After 4.0 h, there are 1.6 x 106 bacterial cells in the sample. Calculate the growth rate of the bacterial population for the given time interval.
(Record your answer in sc

7dog47   1764   3 Replies

alyssa_19

Factors that affect population growth are???

Factors that affect population growth are???

1. Factors that affect population growth are:
   a) only biotic factors
   b) biogeochemical cycles
   c) only abiotic factors
   d) both biotic and abiotic factors

* I think its d*

2. The highest possible cgr (per c

7dog47   2723   4 Replies

ILoveBIO30

How does the evolution of hominins relate to the species concept?

How does the evolution of hominins relate to the species concept?

How does the evolution of hominins relate to the species concept?

88Meme   42   1 Reply

alissajoanne

What percentage of genetic variation in yeast genotypes was associated with geographic location?

What percentage of genetic variation in yeast genotypes was associated with geographic location?

[html]What percentage of genetic variation in yeast genotypes was associated with geographic location?


▸

88Meme   56   1 Reply

Elliejraff

In which part of the mammalian urinary system does filtrate undergo a dramatic decrease in osmolarity?

In which part of the mammalian urinary system does filtrate undergo a dramatic decrease in osmolarity?

[html]In which part of the mammalian urinary system does filtrate undergo a dramatic decrease in osmolarity?


▸

88Meme   58   1 Reply

mr,slickz

What strategies do plants use to capture phosphorus from phosphorus-poor soils?

What strategies do plants use to capture phosphorus from phosphorus-poor soils?

[html]What strategies do plants use to capture phosphorus from phosphorus-poor soils?


▸

88Meme   47   1 Reply

bbygirll2017

Do I have the correct two primers (6 nucleotides long) to amplify this DNA?

Do I have the correct two primers (6 nucleotides long) to amplify this DNA?

Sequence:
5'ATCGATGTGCTATACATGTTAACAC3'
3'TAGCTACACGATATGTACACTTGTG5'

In order to amplify DNA sequences, should I always use the first six of the top strand and the last six of the bottom strand? So in this

920073545   329   1 Reply

bio_man

How do I find the exact length of this lambda DNA?

How do I find the exact length of this lambda DNA?

I'm working on an assignment dealing with analyzing lambda DNA digestions and given a table like this:
Base Pairs          Distance Measured
23,130               Do not measured
9,416               2.9 cm
6,557               3.5 cm
4,361               

920073545   824   11 Replies

920073545

Why are the lengths different between uncut and cut lambda DNA?

Why are the lengths different between uncut and cut lambda DNA?

We were given a picture of the results of gel electrophoresis with lambda DNA- uncut, cut by BAM HI, cut by EcoRI, and HINDIII- and some calculations are made to find the lengths.
If I add up the base pairs of each enzyme, I should technical

920073545   335   2 Replies

ortho2122