Top Posters
Since Sunday
g
2
T
2
1
1
Are you an expert?
Quickly gain a reputation by helping other students with their questions. When students see your nickname, they'll immediately associate your answer with credibility and expertise. Also, earn credits for sharing your knowledge and redeem them for rewards.
I am good at  
were unaware it was possible to reach India over land. were in search of spices feared milita
were unaware it was possible to reach India over land. were in search of spices feared milita

      
were unaware it was possible to reach India over land.

      
were in search of spices

      
feared military confrontation with Muslims.

      
wanted to test their naval capabilities
History   Ahmedfb   460   Asked 8 years ago
A DRUG That Erases BAD-MEMORIES But Keeps Other Memories Intact !!!
A DRUG That Erases BAD-MEMORIES But Keeps Other Memories Intact !!!

At the University of Montreal, researchers have found a drug that seems able to decrease a person’s recall of a bad memory. It’s not exactly Eternal Sunshine of the Spotless Mind, but it’s a pretty remarkable step down the road to activ
News Articles and Discussion   bio_man   822   Asked 13 years ago
A GREAT STEP Towards AUGMENTED HUMANS And Animals: Now, Virtually Any Specific
A GREAT STEP Towards AUGMENTED HUMANS And Animals: Now, Virtually Any Specific
Genome editing, a next step in genetic therapy, corrects hemophilia in animals

Using an innovative gene therapy technique called genome editing that hones in on the precise location of mutated DNA, scientists have treated the blood clotting disorder hemophilia in mice. This is the first time that genome editing, which pre
News Articles and Discussion   bio_man   1086   Asked 13 years ago
Active sodium ion pumping in a membrane
Active sodium ion pumping in a membrane
Hello

Assume I have a membrane of volume V, and potential Vm across it.Inside, there's some concentration of sodium Cna(in), chloride Ccl(in) and neutral macromolecule b (Cb).

Also, the sodium is being actively transported from the inside to the outside with Jna_a the active current density (constant). The outside has also some concentration of sodium Cna(
Biochemistry   M_M_S   417   Asked 8 years ago
american public university(ECON101Microeconom)
american public university(ECON101Microeconom)
I'm looking for any QUIZ or TEST for APUS please let me know
Other   BlankMan24   381   Asked 10 years ago
Beer's law problems?
Beer's law problems?
Hey everyone I'm having issues with a problem on my protein concentration lab.
"To test your understanding of the color wheel and Beer's law, use the space below to graph the relationship between concentration and absorbance for three substances: A, which is green, B, which is yellow, and C, which is red, when they are illuminated with green light. Let the x axis
Introductory Courses   Fightboy   7512   Asked 10 years ago
biological level?
biological level?
Write a short scenario (ex. a disruption in the environment) of how level is interconnected. What are the possible impacts of your example on the different biological levels? Define each biological level. Try to connect at least 3 levels.
Organisms -----> Populations -----> commnities ------> ecosystems --------> biome

thanks in advance
General Biology   Taylor14   458   Asked 10 years ago
case study on urinary system
case study on urinary system
It took the diagnosis of high blood pressure (hypertension) at the age of 45 to shock Max into taking better care of himself. A former college football player, he had let himself go, eating too much junk food, drinking too much alcohol, sitting on his chubby bottom for the majority of the last two decades, and even indulging in the frequent habit of smoking cigars. Max’s physician h
Anatomy and Physiology   adoma   6297   Asked 11 years ago
Consider a radiology practice system (as a subsystem of the clinical information systems
Consider a radiology practice system (as a subsystem of the clinical information systems
A4.1 Describe the most typical 5-6 features of a radiology practice system.

A4.2. What criteria would be applicable if you have to choose a particular radiology practice system for a hospital.

A4.3.What physical security means and authentication means would be suitable for a radiology practice system.

Nursing and Clinical   OGPussPounder   227   Asked 7 years ago
Consider the following family history: -Bob has a genetic condition that affect
Consider the following family history: -Bob has a genetic condition that affect
answer: x-linked dominant
General Biology   mcruzramirez   419   Asked 10 years ago
Construct an argument for joining such a treaty, detailing the benefits that in
Construct an argument for joining such a treaty, detailing the benefits that in
 The International Criminal Court (ICC) was established to bring justice to those committing crimes against humanity, war crimes, or genocide. It was established as an extension of the Rome Statute, and only has jurisdiction over countries that signed this treaty. At this time, the United States is not part of this agreement, and thus does not fall under its jurisdiction. Construct
Legal Studies   moonwolfe2010   812   Asked 9 years ago
During chlorophyll biosynthesis, which wavelength of light, if at all, would produce the optimum ...
During chlorophyll biosynthesis, which wavelength of light, if at all, would produce the optimum ...
I am performing an experiment of chlorophyll biosynthesis, so had a question about whether during the reduction of the D ring by NADPH in chlorophyll biosynthesis, is the process affected by different wavelengths of light. It will also be very helpful if someone could suggest me a site to get data on the amount of chlorophyll in a mung bean and barley plants
Upper-Year Courses   jashdhill   1101   Asked 8 years ago
Expression and function of ALCAM in esophageal cancer
Expression and function of ALCAM in esophageal cancer
Way to migrate to lymphoid tissue, proliferate to form metastases. Cross-lymphatic endothelial migration of esophageal cancer cells for the treatment of esophageal cancer lymph node metastasis to provide new ideas.

Activation of leukocyte adhesion molecules ALCAM(activated leukocyte cell adhesion molecule)
General Biology   yoxi5236   774   Asked 13 years ago
Find the size of amplicon if we use the following PCR-primers for human GLUT1
Find the size of amplicon if we use the following PCR-primers for human GLUT1
Hello,

I have an exericise to solve at home:


What is the size of GLUT1 amplicon if we use the following PCR-primers for human
GLUT1? Please remember that we used human GLUT1 cDNA as a template.

GLUT1 sense: 5´AACTCTTCAGCCAGGGTCCAC 3´

GLUT1 antisense: 5´CACAGTGAAGATGATGAAGAC 3´


I tried to solve it myself but I d
Genetics and Developmental Biology   mashu   489   Asked 9 years ago
For each statement, the distribution of a population is illustrated before a selective force causes ...
For each statement, the distribution of a population is illustrated before a selective force causes ...
 For each statement, the distribution of a population is illustrated before a selective force causes the population to evolve.

i. Indicate where on the graph the selection takes place (it could be one place or two) by placing an “x” (or two if necessary).
ii. Draw the new population distribution on the graph.
iii. Indicate the type of selection taking place.
General Biology   123daisy   1158   Asked 8 years ago
How do we come up with the age of Miocene for the volcanic plug? I
How do we come up with the age of Miocene for the volcanic plug? I
 How do we come up with the age of Miocene for the volcanic plug? I
Geography and Earth Sciences   tdktwan   3479   Asked 10 years ago
Identify and delineate on several factors
Identify and delineate on several factors
 Identify and delineate on several factors that help explain the disparity between the high aggregate costs of fire for the nation, states, and communities, and lower perceptions of fire risks and costs. What are the ramifications of ignoring fire prevention and education?

Any help would be fantastic! Please and thank you in advance if you can give me any helpful and usef
Other   Doggison   995   Asked 9 years ago
Immunological Memory
Immunological Memory
AUSTRALIAN NATUROPATHIC NETWORK

The ability of the body to defend itself against specific invading agents such as bacteria, toxins, viruses and foreign tissues is called immunity. Immunity is said to have a memory for most invading agents encountered before, because a second encounter with the same agent prompts a rapid and vigorous response. This is called immunological
Other   girlatwork   878   Asked 12 years ago
IMPORTANT RECEPTOR Of The Immune System ( TLR4 ) Can Be Used To Fight SUPERBUGS
IMPORTANT RECEPTOR Of The Immune System ( TLR4 ) Can Be Used To Fight SUPERBUGS
A major step forward in fighting superbugs



New research has identified a novel mechanism by which humans can defend themselves against the well known hospital superbug, Clostridium difficile.  The study provides us wi
News Articles and Discussion   bio_man   1077   Asked 13 years ago
In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the d
In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the d
In Drosophilia ebony body colour is caused by the recessive allele eb and grey body colour by the dominant allele eb+. Vestigal wings are produced by the recessive allele vg and long wings by the dominant allele vg+.

When mated, a female with ebony body colour and vestigial wings produces the following offspring.

41 flies with ebony body and long wings
44f
General Biology   mishaaus   1250   Asked 13 years ago
International Conference “Plant Genome Editing & Genome Engineering”
International Conference “Plant Genome Editing & Genome Engineering”
Welcome to the International Conference “Plant Genome Editing & Genome Engineering”!

Genome Editing and Genome Engineering are revolutionizing Life Sciences and Plant Biotechnology that seek to develop new technologies for the precise manipulation of genes and genomes in cellula and in vivo. In addition to its use for advancing our understanding of basic biology, geno
Off-Topic Room   AlisherTouraev   513   Asked 8 years ago
It is estimated that about 75% of suspects routinely waive their Miranda rights
It is estimated that about 75% of suspects routinely waive their Miranda rights
 It is estimated that about 75% of suspects routinely waive their Miranda rights and talk to the police.1  Given that, discuss the impact of the Berghuis decision on law enforcement
Legal Studies   ebinilucas   1043   Asked 9 years ago
Kent v. United States, the \3.S. Supreme Court ruled that a child alleged to be
Kent v. United States, the \3.S. Supreme Court ruled that a child alleged to be
Corrections in america
Legal Studies   baruch   332   Asked 10 years ago
Kwashiorkor can be defined as moderate energy deficit with severe protein
Kwashiorkor can be defined as moderate energy deficit with severe protein
Kwashiorkor can be defined as moderate energy deficit with severe protein deficit. It is often seen in the light of increased protein needs due to infections. The affected children often have bulging belly and infections.

A) Provide biochemical reasons for the following symptoms associated with Kwashiorkor: Hepatomegaly, fatty liver, and distended abdomen

B) W
Health, Nutrition, and Food Sciences   organicdream   6263   Asked 11 years ago
Larnygeal Cancer Hesi Case Study
Larnygeal Cancer Hesi Case Study
COPD c Pneumonia

1A      11B
2A      12B
3C      13D
4D      14B
5C      15D
6 100   16A
7C      17C
8D      18A
9B      19B,E
10B
Nursing and Clinical   Tgates6   1009   Asked 10 years ago
Leading pests by using sicience
Leading pests by using sicience
Hello~
i would like to design a device of leading pest by sound source.
Do you have any recommends to me? Slight Smile
News Articles and Discussion   ling1995   306   Asked 8 years ago
need help please
need help please
1- Baur and Shull crossed broad-leaved females of the plant species Lychnis alba to narrow-leaved males and obtained an F1 consisting of males and females that were all broad leaved, but the F2 were of two kinds, broad-leaved and narrow-leaved.  Explain the type of sex determination system that exists in Lychnias alba.  SHOW YOUR WORK .
a- Type of system?
b- what
Genetics and Developmental Biology   rony   672   Asked 11 years ago
NURSING
NURSING
I need question bank for : nursing a concept based approach to learning. ASAP!
General Biology   nursem   615   Asked 13 years ago
Parameters affecting adaptation scenarios
Parameters affecting adaptation scenarios
. Parameters affecting adaptation scenarios

If we think of adaptation as an adjustment and environmental changes, we have seen that adaptive mutation can occur as a result of two scenarios - different from the population there was no prior adaptive change, or from a new mutation that appeared after the change.

A.. What situation has had more different from the
Other   asaf   864   Asked 14 years ago
Part One: In your textbook you should have noticed that Tiger Woods was the hig
Part One: In your textbook you should have noticed that Tiger Woods was the hig
 Part One: In your textbook you should have noticed that Tiger Woods was the highest compensated athlete in terms of salary and endorsements. However, Woods lost some endorsements for breaches or perceived breaches of his endorsement contracts. Find one example of an endorsement contract that was breached and the reasoning given by the endorser. Please discuss the situation and list
Legal Studies   methoo   563   Asked 9 years ago
Physioex 9.0 Exercise 3 Predict/Stop and Think Questions Activity 6
Physioex 9.0 Exercise 3 Predict/Stop and Think Questions Activity 6
Experiment Results
Predict Question:
Predict Question: What effect will the increased stimulus intensity have on the frequency of action potentials?
Your answer : b. The frequency of action potentials will remain the same.
Stop & Think Questions:
4. At the site of stimulation, the stimulus keeps the membrane of the axon at threshold for a long time, but
Anatomy and Physiology   trin   18599   Asked 12 years ago
Probability and Genetics Lab
Probability and Genetics Lab
 Probability and Genetics Lab Report---
Has anyone done this lab before?? HELP




Based on the parents' genotypes, what is the genotypic ratio expected from a monohybrid cross between the two parents for the trait?


Question 2

Based on the genotypic ratio from question 1, what is the expected probability of each genotype
General Biology   BeautifulOne   4013   Asked 10 years ago
RLC circuit help
RLC circuit help
An RLC circuit with a 10μF capacitor is connected to a variable-frequency power supply with an rms output voltage of 5.3V . The rms current in the circuit as a function of the driving frequency appears as in figure. What are the value of the resistor? What are the value of the inductor?
Physics   Cutbait   440   Asked 11 years ago
Smart Individual Used Very Obsolete And Forgotten Law Clauses To Buy A Luxuriou
Smart Individual Used Very Obsolete And Forgotten Law Clauses To Buy A Luxuriou
Man Buys Texas Home For $16

Kenneth Robinson of Texas used an obscure law known as adverse possession to get the rights to a house for sixteen dollars. Cenk Uygur and Ana Kasparian discuss.

Off-Topic Room   bio_man   971   Asked 13 years ago
SOCI 332 WEEK 2 ASSIGNMENTS
SOCI 332 WEEK 2 ASSIGNMENTS
Can someone PLEASE help me with Week 2 assignments SOCI 332??
Other   RaginCajun13   654   Asked 10 years ago
The following diagrams all show the same comet orbit, but each one shows the comet passing through ...
The following diagrams all show the same comet orbit, but each one shows the comet passing through ...

The following diagrams all show the same comet orbit, but each one shows the comet passing through a different segment of its orbit around the Sun. During each segment, a line drawn from the Sun to the comet sweeps out a triangular-shaped, shaded area. Assume that all the shaded regions have exactly the same area. Rank the segments of the comet’s orbit from left to right based
Environmental and Conservation Biology   stephanie.jaso   655   Asked 8 years ago
The intracellular cAMP level is lower after time t than before.
The intracellular cAMP level is lower after time t than before.
 The intracellular cAMP level is lower after time t than before.
Select all that apply.
Select all that apply.
   It is true of the cells transferred to medium L.
   It is true of the cells transferred to medium G.
   It is true of the cells left in medium B.
   It is true of none of the cells.
Cell Biology   Tariq_alam99   2692   Asked 10 years ago
The rate of glucose consumption per cell is approximately the same after time t
The rate of glucose consumption per cell is approximately the same after time t
 The rate of glucose consumption per cell is approximately the same after time t as before.
Select all that apply.
Select all that apply.
   It is true of the cells transferred to medium L.
   It is true of the cells transferred to medium G.
   It is true of the cells left in medium B.
   It is true of none of the cells.
Cell Biology   Tariq_alam99   1542   Asked 10 years ago
what statement attached is completed by the information below
what statement attached is completed by the information below
#7      A positively charged test object is placed in the electric field caused by a (-) charged object. The test object is to the left of the negatively charged object. At the position of the test object, the correct direction of the Field is ________i________ and the correct direction of the force on the test object is__ii_____
 
****Please see atta
High School Level Science   angie19   461   Asked 8 years ago
What would be an effective plan for Israel to avert these attacks?
What would be an effective plan for Israel to avert these attacks?
 What would be an effective plan for Israel to avert these attacks?
Legal Studies   Laura09   424   Asked 8 years ago
Explore
Post your homework questions and get free online help from our incredible volunteers
  1414 People Browsing
Your Opinion
Which is the best fuel for late night cramming?
Votes: 512